ID: 924974633

View in Genome Browser
Species Human (GRCh38)
Location 2:161432-161454
Sequence GATGCAACTGTTTCCCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924974633_924974645 4 Left 924974633 2:161432-161454 CCCTGTGGGGAAACAGTTGCATC No data
Right 924974645 2:161459-161481 CCGGGATGGTGGTTCCACTGGGG No data
924974633_924974648 23 Left 924974633 2:161432-161454 CCCTGTGGGGAAACAGTTGCATC No data
Right 924974648 2:161478-161500 GGGGCTGTTGCGGTGCTCACAGG No data
924974633_924974650 27 Left 924974633 2:161432-161454 CCCTGTGGGGAAACAGTTGCATC No data
Right 924974650 2:161482-161504 CTGTTGCGGTGCTCACAGGGAGG No data
924974633_924974646 13 Left 924974633 2:161432-161454 CCCTGTGGGGAAACAGTTGCATC No data
Right 924974646 2:161468-161490 TGGTTCCACTGGGGCTGTTGCGG No data
924974633_924974641 -7 Left 924974633 2:161432-161454 CCCTGTGGGGAAACAGTTGCATC No data
Right 924974641 2:161448-161470 TTGCATCGGGGCCGGGATGGTGG No data
924974633_924974640 -10 Left 924974633 2:161432-161454 CCCTGTGGGGAAACAGTTGCATC No data
Right 924974640 2:161445-161467 CAGTTGCATCGGGGCCGGGATGG No data
924974633_924974643 3 Left 924974633 2:161432-161454 CCCTGTGGGGAAACAGTTGCATC No data
Right 924974643 2:161458-161480 GCCGGGATGGTGGTTCCACTGGG No data
924974633_924974649 24 Left 924974633 2:161432-161454 CCCTGTGGGGAAACAGTTGCATC No data
Right 924974649 2:161479-161501 GGGCTGTTGCGGTGCTCACAGGG No data
924974633_924974651 30 Left 924974633 2:161432-161454 CCCTGTGGGGAAACAGTTGCATC No data
Right 924974651 2:161485-161507 TTGCGGTGCTCACAGGGAGGAGG No data
924974633_924974642 2 Left 924974633 2:161432-161454 CCCTGTGGGGAAACAGTTGCATC No data
Right 924974642 2:161457-161479 GGCCGGGATGGTGGTTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924974633 Original CRISPR GATGCAACTGTTTCCCCACA GGG (reversed) Intergenic