ID: 924974634

View in Genome Browser
Species Human (GRCh38)
Location 2:161433-161455
Sequence CGATGCAACTGTTTCCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924974634_924974650 26 Left 924974634 2:161433-161455 CCTGTGGGGAAACAGTTGCATCG No data
Right 924974650 2:161482-161504 CTGTTGCGGTGCTCACAGGGAGG No data
924974634_924974643 2 Left 924974634 2:161433-161455 CCTGTGGGGAAACAGTTGCATCG No data
Right 924974643 2:161458-161480 GCCGGGATGGTGGTTCCACTGGG No data
924974634_924974646 12 Left 924974634 2:161433-161455 CCTGTGGGGAAACAGTTGCATCG No data
Right 924974646 2:161468-161490 TGGTTCCACTGGGGCTGTTGCGG No data
924974634_924974648 22 Left 924974634 2:161433-161455 CCTGTGGGGAAACAGTTGCATCG No data
Right 924974648 2:161478-161500 GGGGCTGTTGCGGTGCTCACAGG No data
924974634_924974641 -8 Left 924974634 2:161433-161455 CCTGTGGGGAAACAGTTGCATCG No data
Right 924974641 2:161448-161470 TTGCATCGGGGCCGGGATGGTGG No data
924974634_924974652 30 Left 924974634 2:161433-161455 CCTGTGGGGAAACAGTTGCATCG No data
Right 924974652 2:161486-161508 TGCGGTGCTCACAGGGAGGAGGG No data
924974634_924974649 23 Left 924974634 2:161433-161455 CCTGTGGGGAAACAGTTGCATCG No data
Right 924974649 2:161479-161501 GGGCTGTTGCGGTGCTCACAGGG No data
924974634_924974642 1 Left 924974634 2:161433-161455 CCTGTGGGGAAACAGTTGCATCG No data
Right 924974642 2:161457-161479 GGCCGGGATGGTGGTTCCACTGG No data
924974634_924974651 29 Left 924974634 2:161433-161455 CCTGTGGGGAAACAGTTGCATCG No data
Right 924974651 2:161485-161507 TTGCGGTGCTCACAGGGAGGAGG No data
924974634_924974645 3 Left 924974634 2:161433-161455 CCTGTGGGGAAACAGTTGCATCG No data
Right 924974645 2:161459-161481 CCGGGATGGTGGTTCCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924974634 Original CRISPR CGATGCAACTGTTTCCCCAC AGG (reversed) Intergenic