ID: 924974642

View in Genome Browser
Species Human (GRCh38)
Location 2:161457-161479
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924974634_924974642 1 Left 924974634 2:161433-161455 CCTGTGGGGAAACAGTTGCATCG No data
Right 924974642 2:161457-161479 GGCCGGGATGGTGGTTCCACTGG No data
924974629_924974642 21 Left 924974629 2:161413-161435 CCATGGCTATGTGTGGGGACCCT No data
Right 924974642 2:161457-161479 GGCCGGGATGGTGGTTCCACTGG No data
924974633_924974642 2 Left 924974633 2:161432-161454 CCCTGTGGGGAAACAGTTGCATC No data
Right 924974642 2:161457-161479 GGCCGGGATGGTGGTTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type