ID: 924974789

View in Genome Browser
Species Human (GRCh38)
Location 2:162693-162715
Sequence TGCAGGCTGGTCTCCTGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924974789_924974802 21 Left 924974789 2:162693-162715 CCCAAGCAGGAGACCAGCCTGCA No data
Right 924974802 2:162737-162759 TGGCCACTCTGTGGTTGGGCTGG No data
924974789_924974797 1 Left 924974789 2:162693-162715 CCCAAGCAGGAGACCAGCCTGCA No data
Right 924974797 2:162717-162739 AGAGGGGGCCTATGTCACTCTGG No data
924974789_924974799 12 Left 924974789 2:162693-162715 CCCAAGCAGGAGACCAGCCTGCA No data
Right 924974799 2:162728-162750 ATGTCACTCTGGCCACTCTGTGG No data
924974789_924974801 17 Left 924974789 2:162693-162715 CCCAAGCAGGAGACCAGCCTGCA No data
Right 924974801 2:162733-162755 ACTCTGGCCACTCTGTGGTTGGG No data
924974789_924974800 16 Left 924974789 2:162693-162715 CCCAAGCAGGAGACCAGCCTGCA No data
Right 924974800 2:162732-162754 CACTCTGGCCACTCTGTGGTTGG No data
924974789_924974804 27 Left 924974789 2:162693-162715 CCCAAGCAGGAGACCAGCCTGCA No data
Right 924974804 2:162743-162765 CTCTGTGGTTGGGCTGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924974789 Original CRISPR TGCAGGCTGGTCTCCTGCTT GGG (reversed) Intergenic
No off target data available for this crispr