ID: 924974790

View in Genome Browser
Species Human (GRCh38)
Location 2:162694-162716
Sequence CTGCAGGCTGGTCTCCTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924974790_924974799 11 Left 924974790 2:162694-162716 CCAAGCAGGAGACCAGCCTGCAG No data
Right 924974799 2:162728-162750 ATGTCACTCTGGCCACTCTGTGG No data
924974790_924974801 16 Left 924974790 2:162694-162716 CCAAGCAGGAGACCAGCCTGCAG No data
Right 924974801 2:162733-162755 ACTCTGGCCACTCTGTGGTTGGG No data
924974790_924974802 20 Left 924974790 2:162694-162716 CCAAGCAGGAGACCAGCCTGCAG No data
Right 924974802 2:162737-162759 TGGCCACTCTGTGGTTGGGCTGG No data
924974790_924974800 15 Left 924974790 2:162694-162716 CCAAGCAGGAGACCAGCCTGCAG No data
Right 924974800 2:162732-162754 CACTCTGGCCACTCTGTGGTTGG No data
924974790_924974804 26 Left 924974790 2:162694-162716 CCAAGCAGGAGACCAGCCTGCAG No data
Right 924974804 2:162743-162765 CTCTGTGGTTGGGCTGGCTGTGG No data
924974790_924974797 0 Left 924974790 2:162694-162716 CCAAGCAGGAGACCAGCCTGCAG No data
Right 924974797 2:162717-162739 AGAGGGGGCCTATGTCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924974790 Original CRISPR CTGCAGGCTGGTCTCCTGCT TGG (reversed) Intergenic
No off target data available for this crispr