ID: 924974795

View in Genome Browser
Species Human (GRCh38)
Location 2:162706-162728
Sequence TAGGCCCCCTCTCTGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924974795_924974802 8 Left 924974795 2:162706-162728 CCAGCCTGCAGAGAGGGGGCCTA No data
Right 924974802 2:162737-162759 TGGCCACTCTGTGGTTGGGCTGG No data
924974795_924974799 -1 Left 924974795 2:162706-162728 CCAGCCTGCAGAGAGGGGGCCTA No data
Right 924974799 2:162728-162750 ATGTCACTCTGGCCACTCTGTGG No data
924974795_924974801 4 Left 924974795 2:162706-162728 CCAGCCTGCAGAGAGGGGGCCTA No data
Right 924974801 2:162733-162755 ACTCTGGCCACTCTGTGGTTGGG No data
924974795_924974804 14 Left 924974795 2:162706-162728 CCAGCCTGCAGAGAGGGGGCCTA No data
Right 924974804 2:162743-162765 CTCTGTGGTTGGGCTGGCTGTGG No data
924974795_924974800 3 Left 924974795 2:162706-162728 CCAGCCTGCAGAGAGGGGGCCTA No data
Right 924974800 2:162732-162754 CACTCTGGCCACTCTGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924974795 Original CRISPR TAGGCCCCCTCTCTGCAGGC TGG (reversed) Intergenic
No off target data available for this crispr