ID: 924974797

View in Genome Browser
Species Human (GRCh38)
Location 2:162717-162739
Sequence AGAGGGGGCCTATGTCACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924974789_924974797 1 Left 924974789 2:162693-162715 CCCAAGCAGGAGACCAGCCTGCA No data
Right 924974797 2:162717-162739 AGAGGGGGCCTATGTCACTCTGG No data
924974790_924974797 0 Left 924974790 2:162694-162716 CCAAGCAGGAGACCAGCCTGCAG No data
Right 924974797 2:162717-162739 AGAGGGGGCCTATGTCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924974797 Original CRISPR AGAGGGGGCCTATGTCACTC TGG Intergenic
No off target data available for this crispr