ID: 924974798

View in Genome Browser
Species Human (GRCh38)
Location 2:162725-162747
Sequence CAGAGTGGCCAGAGTGACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924974798_924974804 -5 Left 924974798 2:162725-162747 CCTATGTCACTCTGGCCACTCTG No data
Right 924974804 2:162743-162765 CTCTGTGGTTGGGCTGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924974798 Original CRISPR CAGAGTGGCCAGAGTGACAT AGG (reversed) Intergenic
No off target data available for this crispr