ID: 924974799

View in Genome Browser
Species Human (GRCh38)
Location 2:162728-162750
Sequence ATGTCACTCTGGCCACTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924974795_924974799 -1 Left 924974795 2:162706-162728 CCAGCCTGCAGAGAGGGGGCCTA No data
Right 924974799 2:162728-162750 ATGTCACTCTGGCCACTCTGTGG No data
924974796_924974799 -5 Left 924974796 2:162710-162732 CCTGCAGAGAGGGGGCCTATGTC No data
Right 924974799 2:162728-162750 ATGTCACTCTGGCCACTCTGTGG No data
924974789_924974799 12 Left 924974789 2:162693-162715 CCCAAGCAGGAGACCAGCCTGCA No data
Right 924974799 2:162728-162750 ATGTCACTCTGGCCACTCTGTGG No data
924974790_924974799 11 Left 924974790 2:162694-162716 CCAAGCAGGAGACCAGCCTGCAG No data
Right 924974799 2:162728-162750 ATGTCACTCTGGCCACTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924974799 Original CRISPR ATGTCACTCTGGCCACTCTG TGG Intergenic
No off target data available for this crispr