ID: 924974800

View in Genome Browser
Species Human (GRCh38)
Location 2:162732-162754
Sequence CACTCTGGCCACTCTGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924974796_924974800 -1 Left 924974796 2:162710-162732 CCTGCAGAGAGGGGGCCTATGTC No data
Right 924974800 2:162732-162754 CACTCTGGCCACTCTGTGGTTGG No data
924974795_924974800 3 Left 924974795 2:162706-162728 CCAGCCTGCAGAGAGGGGGCCTA No data
Right 924974800 2:162732-162754 CACTCTGGCCACTCTGTGGTTGG No data
924974790_924974800 15 Left 924974790 2:162694-162716 CCAAGCAGGAGACCAGCCTGCAG No data
Right 924974800 2:162732-162754 CACTCTGGCCACTCTGTGGTTGG No data
924974789_924974800 16 Left 924974789 2:162693-162715 CCCAAGCAGGAGACCAGCCTGCA No data
Right 924974800 2:162732-162754 CACTCTGGCCACTCTGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924974800 Original CRISPR CACTCTGGCCACTCTGTGGT TGG Intergenic
No off target data available for this crispr