ID: 924977093

View in Genome Browser
Species Human (GRCh38)
Location 2:187883-187905
Sequence CAGAGTCTGTGGGTCAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924977093_924977100 27 Left 924977093 2:187883-187905 CCAGGTCTGACCCACAGACTCTG No data
Right 924977100 2:187933-187955 CAGACACAGGTTTTTTAGTCTGG No data
924977093_924977098 14 Left 924977093 2:187883-187905 CCAGGTCTGACCCACAGACTCTG No data
Right 924977098 2:187920-187942 GAAAAAATGTCCACAGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924977093 Original CRISPR CAGAGTCTGTGGGTCAGACC TGG (reversed) Intergenic