ID: 924977095

View in Genome Browser
Species Human (GRCh38)
Location 2:187893-187915
Sequence GTCACTCTGCCAGAGTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924977095_924977101 25 Left 924977095 2:187893-187915 CCCACAGACTCTGGCAGAGTGAC No data
Right 924977101 2:187941-187963 GGTTTTTTAGTCTGGTCACATGG No data
924977095_924977098 4 Left 924977095 2:187893-187915 CCCACAGACTCTGGCAGAGTGAC No data
Right 924977098 2:187920-187942 GAAAAAATGTCCACAGACACAGG No data
924977095_924977100 17 Left 924977095 2:187893-187915 CCCACAGACTCTGGCAGAGTGAC No data
Right 924977100 2:187933-187955 CAGACACAGGTTTTTTAGTCTGG No data
924977095_924977102 30 Left 924977095 2:187893-187915 CCCACAGACTCTGGCAGAGTGAC No data
Right 924977102 2:187946-187968 TTTAGTCTGGTCACATGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924977095 Original CRISPR GTCACTCTGCCAGAGTCTGT GGG (reversed) Intergenic