ID: 924977096

View in Genome Browser
Species Human (GRCh38)
Location 2:187894-187916
Sequence CGTCACTCTGCCAGAGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924977096_924977102 29 Left 924977096 2:187894-187916 CCACAGACTCTGGCAGAGTGACG No data
Right 924977102 2:187946-187968 TTTAGTCTGGTCACATGGCTAGG No data
924977096_924977101 24 Left 924977096 2:187894-187916 CCACAGACTCTGGCAGAGTGACG No data
Right 924977101 2:187941-187963 GGTTTTTTAGTCTGGTCACATGG No data
924977096_924977098 3 Left 924977096 2:187894-187916 CCACAGACTCTGGCAGAGTGACG No data
Right 924977098 2:187920-187942 GAAAAAATGTCCACAGACACAGG No data
924977096_924977100 16 Left 924977096 2:187894-187916 CCACAGACTCTGGCAGAGTGACG No data
Right 924977100 2:187933-187955 CAGACACAGGTTTTTTAGTCTGG No data
924977096_924977103 30 Left 924977096 2:187894-187916 CCACAGACTCTGGCAGAGTGACG No data
Right 924977103 2:187947-187969 TTAGTCTGGTCACATGGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924977096 Original CRISPR CGTCACTCTGCCAGAGTCTG TGG (reversed) Intergenic