ID: 924977100

View in Genome Browser
Species Human (GRCh38)
Location 2:187933-187955
Sequence CAGACACAGGTTTTTTAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924977096_924977100 16 Left 924977096 2:187894-187916 CCACAGACTCTGGCAGAGTGACG No data
Right 924977100 2:187933-187955 CAGACACAGGTTTTTTAGTCTGG No data
924977095_924977100 17 Left 924977095 2:187893-187915 CCCACAGACTCTGGCAGAGTGAC No data
Right 924977100 2:187933-187955 CAGACACAGGTTTTTTAGTCTGG No data
924977093_924977100 27 Left 924977093 2:187883-187905 CCAGGTCTGACCCACAGACTCTG No data
Right 924977100 2:187933-187955 CAGACACAGGTTTTTTAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924977100 Original CRISPR CAGACACAGGTTTTTTAGTC TGG Intergenic
No off target data available for this crispr