ID: 924979674

View in Genome Browser
Species Human (GRCh38)
Location 2:208101-208123
Sequence ATTTCAACTTAGGAGTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924979674_924979685 6 Left 924979674 2:208101-208123 CCCCCAAACTCCTAAGTTGAAAT No data
Right 924979685 2:208130-208152 CCCAGTTTGACGGGGTTAGGAGG No data
924979674_924979682 3 Left 924979674 2:208101-208123 CCCCCAAACTCCTAAGTTGAAAT No data
Right 924979682 2:208127-208149 CTCCCCAGTTTGACGGGGTTAGG No data
924979674_924979690 19 Left 924979674 2:208101-208123 CCCCCAAACTCCTAAGTTGAAAT No data
Right 924979690 2:208143-208165 GGTTAGGAGGGGTGTTGAGGAGG No data
924979674_924979680 -3 Left 924979674 2:208101-208123 CCCCCAAACTCCTAAGTTGAAAT No data
Right 924979680 2:208121-208143 AATCTACTCCCCAGTTTGACGGG No data
924979674_924979679 -4 Left 924979674 2:208101-208123 CCCCCAAACTCCTAAGTTGAAAT No data
Right 924979679 2:208120-208142 AAATCTACTCCCCAGTTTGACGG No data
924979674_924979681 -2 Left 924979674 2:208101-208123 CCCCCAAACTCCTAAGTTGAAAT No data
Right 924979681 2:208122-208144 ATCTACTCCCCAGTTTGACGGGG No data
924979674_924979687 7 Left 924979674 2:208101-208123 CCCCCAAACTCCTAAGTTGAAAT No data
Right 924979687 2:208131-208153 CCAGTTTGACGGGGTTAGGAGGG No data
924979674_924979688 8 Left 924979674 2:208101-208123 CCCCCAAACTCCTAAGTTGAAAT No data
Right 924979688 2:208132-208154 CAGTTTGACGGGGTTAGGAGGGG No data
924979674_924979689 16 Left 924979674 2:208101-208123 CCCCCAAACTCCTAAGTTGAAAT No data
Right 924979689 2:208140-208162 CGGGGTTAGGAGGGGTGTTGAGG No data
924979674_924979691 27 Left 924979674 2:208101-208123 CCCCCAAACTCCTAAGTTGAAAT No data
Right 924979691 2:208151-208173 GGGGTGTTGAGGAGGTGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924979674 Original CRISPR ATTTCAACTTAGGAGTTTGG GGG (reversed) Intergenic