ID: 924979677

View in Genome Browser
Species Human (GRCh38)
Location 2:208104-208126
Sequence TAGATTTCAACTTAGGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924979677_924979688 5 Left 924979677 2:208104-208126 CCAAACTCCTAAGTTGAAATCTA No data
Right 924979688 2:208132-208154 CAGTTTGACGGGGTTAGGAGGGG No data
924979677_924979685 3 Left 924979677 2:208104-208126 CCAAACTCCTAAGTTGAAATCTA No data
Right 924979685 2:208130-208152 CCCAGTTTGACGGGGTTAGGAGG No data
924979677_924979691 24 Left 924979677 2:208104-208126 CCAAACTCCTAAGTTGAAATCTA No data
Right 924979691 2:208151-208173 GGGGTGTTGAGGAGGTGACGAGG No data
924979677_924979680 -6 Left 924979677 2:208104-208126 CCAAACTCCTAAGTTGAAATCTA No data
Right 924979680 2:208121-208143 AATCTACTCCCCAGTTTGACGGG No data
924979677_924979687 4 Left 924979677 2:208104-208126 CCAAACTCCTAAGTTGAAATCTA No data
Right 924979687 2:208131-208153 CCAGTTTGACGGGGTTAGGAGGG No data
924979677_924979692 29 Left 924979677 2:208104-208126 CCAAACTCCTAAGTTGAAATCTA No data
Right 924979692 2:208156-208178 GTTGAGGAGGTGACGAGGTCTGG No data
924979677_924979681 -5 Left 924979677 2:208104-208126 CCAAACTCCTAAGTTGAAATCTA No data
Right 924979681 2:208122-208144 ATCTACTCCCCAGTTTGACGGGG No data
924979677_924979689 13 Left 924979677 2:208104-208126 CCAAACTCCTAAGTTGAAATCTA No data
Right 924979689 2:208140-208162 CGGGGTTAGGAGGGGTGTTGAGG No data
924979677_924979690 16 Left 924979677 2:208104-208126 CCAAACTCCTAAGTTGAAATCTA No data
Right 924979690 2:208143-208165 GGTTAGGAGGGGTGTTGAGGAGG No data
924979677_924979682 0 Left 924979677 2:208104-208126 CCAAACTCCTAAGTTGAAATCTA No data
Right 924979682 2:208127-208149 CTCCCCAGTTTGACGGGGTTAGG No data
924979677_924979679 -7 Left 924979677 2:208104-208126 CCAAACTCCTAAGTTGAAATCTA No data
Right 924979679 2:208120-208142 AAATCTACTCCCCAGTTTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924979677 Original CRISPR TAGATTTCAACTTAGGAGTT TGG (reversed) Intergenic
No off target data available for this crispr