ID: 924979678

View in Genome Browser
Species Human (GRCh38)
Location 2:208111-208133
Sequence TGGGGAGTAGATTTCAACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924979678_924979695 27 Left 924979678 2:208111-208133 CCTAAGTTGAAATCTACTCCCCA No data
Right 924979695 2:208161-208183 GGAGGTGACGAGGTCTGGAGGGG No data
924979678_924979694 26 Left 924979678 2:208111-208133 CCTAAGTTGAAATCTACTCCCCA No data
Right 924979694 2:208160-208182 AGGAGGTGACGAGGTCTGGAGGG No data
924979678_924979693 25 Left 924979678 2:208111-208133 CCTAAGTTGAAATCTACTCCCCA No data
Right 924979693 2:208159-208181 GAGGAGGTGACGAGGTCTGGAGG No data
924979678_924979690 9 Left 924979678 2:208111-208133 CCTAAGTTGAAATCTACTCCCCA No data
Right 924979690 2:208143-208165 GGTTAGGAGGGGTGTTGAGGAGG No data
924979678_924979689 6 Left 924979678 2:208111-208133 CCTAAGTTGAAATCTACTCCCCA No data
Right 924979689 2:208140-208162 CGGGGTTAGGAGGGGTGTTGAGG No data
924979678_924979685 -4 Left 924979678 2:208111-208133 CCTAAGTTGAAATCTACTCCCCA No data
Right 924979685 2:208130-208152 CCCAGTTTGACGGGGTTAGGAGG No data
924979678_924979687 -3 Left 924979678 2:208111-208133 CCTAAGTTGAAATCTACTCCCCA No data
Right 924979687 2:208131-208153 CCAGTTTGACGGGGTTAGGAGGG No data
924979678_924979688 -2 Left 924979678 2:208111-208133 CCTAAGTTGAAATCTACTCCCCA No data
Right 924979688 2:208132-208154 CAGTTTGACGGGGTTAGGAGGGG No data
924979678_924979691 17 Left 924979678 2:208111-208133 CCTAAGTTGAAATCTACTCCCCA No data
Right 924979691 2:208151-208173 GGGGTGTTGAGGAGGTGACGAGG No data
924979678_924979682 -7 Left 924979678 2:208111-208133 CCTAAGTTGAAATCTACTCCCCA No data
Right 924979682 2:208127-208149 CTCCCCAGTTTGACGGGGTTAGG No data
924979678_924979692 22 Left 924979678 2:208111-208133 CCTAAGTTGAAATCTACTCCCCA No data
Right 924979692 2:208156-208178 GTTGAGGAGGTGACGAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924979678 Original CRISPR TGGGGAGTAGATTTCAACTT AGG (reversed) Intergenic
No off target data available for this crispr