ID: 924979679

View in Genome Browser
Species Human (GRCh38)
Location 2:208120-208142
Sequence AAATCTACTCCCCAGTTTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924979677_924979679 -7 Left 924979677 2:208104-208126 CCAAACTCCTAAGTTGAAATCTA No data
Right 924979679 2:208120-208142 AAATCTACTCCCCAGTTTGACGG No data
924979674_924979679 -4 Left 924979674 2:208101-208123 CCCCCAAACTCCTAAGTTGAAAT No data
Right 924979679 2:208120-208142 AAATCTACTCCCCAGTTTGACGG No data
924979675_924979679 -5 Left 924979675 2:208102-208124 CCCCAAACTCCTAAGTTGAAATC No data
Right 924979679 2:208120-208142 AAATCTACTCCCCAGTTTGACGG No data
924979676_924979679 -6 Left 924979676 2:208103-208125 CCCAAACTCCTAAGTTGAAATCT No data
Right 924979679 2:208120-208142 AAATCTACTCCCCAGTTTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924979679 Original CRISPR AAATCTACTCCCCAGTTTGA CGG Intergenic
No off target data available for this crispr