ID: 924979684

View in Genome Browser
Species Human (GRCh38)
Location 2:208130-208152
Sequence CCTCCTAACCCCGTCAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924979684_924979692 3 Left 924979684 2:208130-208152 CCCAGTTTGACGGGGTTAGGAGG No data
Right 924979692 2:208156-208178 GTTGAGGAGGTGACGAGGTCTGG No data
924979684_924979690 -10 Left 924979684 2:208130-208152 CCCAGTTTGACGGGGTTAGGAGG No data
Right 924979690 2:208143-208165 GGTTAGGAGGGGTGTTGAGGAGG No data
924979684_924979694 7 Left 924979684 2:208130-208152 CCCAGTTTGACGGGGTTAGGAGG No data
Right 924979694 2:208160-208182 AGGAGGTGACGAGGTCTGGAGGG No data
924979684_924979693 6 Left 924979684 2:208130-208152 CCCAGTTTGACGGGGTTAGGAGG No data
Right 924979693 2:208159-208181 GAGGAGGTGACGAGGTCTGGAGG No data
924979684_924979695 8 Left 924979684 2:208130-208152 CCCAGTTTGACGGGGTTAGGAGG No data
Right 924979695 2:208161-208183 GGAGGTGACGAGGTCTGGAGGGG No data
924979684_924979696 18 Left 924979684 2:208130-208152 CCCAGTTTGACGGGGTTAGGAGG No data
Right 924979696 2:208171-208193 AGGTCTGGAGGGGAGCCCCATGG No data
924979684_924979691 -2 Left 924979684 2:208130-208152 CCCAGTTTGACGGGGTTAGGAGG No data
Right 924979691 2:208151-208173 GGGGTGTTGAGGAGGTGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924979684 Original CRISPR CCTCCTAACCCCGTCAAACT GGG (reversed) Intergenic
No off target data available for this crispr