ID: 924979686

View in Genome Browser
Species Human (GRCh38)
Location 2:208131-208153
Sequence CCCTCCTAACCCCGTCAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924979686_924979696 17 Left 924979686 2:208131-208153 CCAGTTTGACGGGGTTAGGAGGG No data
Right 924979696 2:208171-208193 AGGTCTGGAGGGGAGCCCCATGG No data
924979686_924979692 2 Left 924979686 2:208131-208153 CCAGTTTGACGGGGTTAGGAGGG No data
Right 924979692 2:208156-208178 GTTGAGGAGGTGACGAGGTCTGG No data
924979686_924979693 5 Left 924979686 2:208131-208153 CCAGTTTGACGGGGTTAGGAGGG No data
Right 924979693 2:208159-208181 GAGGAGGTGACGAGGTCTGGAGG No data
924979686_924979691 -3 Left 924979686 2:208131-208153 CCAGTTTGACGGGGTTAGGAGGG No data
Right 924979691 2:208151-208173 GGGGTGTTGAGGAGGTGACGAGG No data
924979686_924979695 7 Left 924979686 2:208131-208153 CCAGTTTGACGGGGTTAGGAGGG No data
Right 924979695 2:208161-208183 GGAGGTGACGAGGTCTGGAGGGG No data
924979686_924979694 6 Left 924979686 2:208131-208153 CCAGTTTGACGGGGTTAGGAGGG No data
Right 924979694 2:208160-208182 AGGAGGTGACGAGGTCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924979686 Original CRISPR CCCTCCTAACCCCGTCAAAC TGG (reversed) Intergenic
No off target data available for this crispr