ID: 924979689

View in Genome Browser
Species Human (GRCh38)
Location 2:208140-208162
Sequence CGGGGTTAGGAGGGGTGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924979676_924979689 14 Left 924979676 2:208103-208125 CCCAAACTCCTAAGTTGAAATCT No data
Right 924979689 2:208140-208162 CGGGGTTAGGAGGGGTGTTGAGG No data
924979678_924979689 6 Left 924979678 2:208111-208133 CCTAAGTTGAAATCTACTCCCCA No data
Right 924979689 2:208140-208162 CGGGGTTAGGAGGGGTGTTGAGG No data
924979677_924979689 13 Left 924979677 2:208104-208126 CCAAACTCCTAAGTTGAAATCTA No data
Right 924979689 2:208140-208162 CGGGGTTAGGAGGGGTGTTGAGG No data
924979674_924979689 16 Left 924979674 2:208101-208123 CCCCCAAACTCCTAAGTTGAAAT No data
Right 924979689 2:208140-208162 CGGGGTTAGGAGGGGTGTTGAGG No data
924979675_924979689 15 Left 924979675 2:208102-208124 CCCCAAACTCCTAAGTTGAAATC No data
Right 924979689 2:208140-208162 CGGGGTTAGGAGGGGTGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924979689 Original CRISPR CGGGGTTAGGAGGGGTGTTG AGG Intergenic
No off target data available for this crispr