ID: 924979691

View in Genome Browser
Species Human (GRCh38)
Location 2:208151-208173
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924979676_924979691 25 Left 924979676 2:208103-208125 CCCAAACTCCTAAGTTGAAATCT No data
Right 924979691 2:208151-208173 GGGGTGTTGAGGAGGTGACGAGG No data
924979678_924979691 17 Left 924979678 2:208111-208133 CCTAAGTTGAAATCTACTCCCCA No data
Right 924979691 2:208151-208173 GGGGTGTTGAGGAGGTGACGAGG No data
924979686_924979691 -3 Left 924979686 2:208131-208153 CCAGTTTGACGGGGTTAGGAGGG No data
Right 924979691 2:208151-208173 GGGGTGTTGAGGAGGTGACGAGG No data
924979684_924979691 -2 Left 924979684 2:208130-208152 CCCAGTTTGACGGGGTTAGGAGG No data
Right 924979691 2:208151-208173 GGGGTGTTGAGGAGGTGACGAGG No data
924979674_924979691 27 Left 924979674 2:208101-208123 CCCCCAAACTCCTAAGTTGAAAT No data
Right 924979691 2:208151-208173 GGGGTGTTGAGGAGGTGACGAGG No data
924979677_924979691 24 Left 924979677 2:208104-208126 CCAAACTCCTAAGTTGAAATCTA No data
Right 924979691 2:208151-208173 GGGGTGTTGAGGAGGTGACGAGG No data
924979675_924979691 26 Left 924979675 2:208102-208124 CCCCAAACTCCTAAGTTGAAATC No data
Right 924979691 2:208151-208173 GGGGTGTTGAGGAGGTGACGAGG No data
924979683_924979691 -1 Left 924979683 2:208129-208151 CCCCAGTTTGACGGGGTTAGGAG No data
Right 924979691 2:208151-208173 GGGGTGTTGAGGAGGTGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type