ID: 924979692

View in Genome Browser
Species Human (GRCh38)
Location 2:208156-208178
Sequence GTTGAGGAGGTGACGAGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924979678_924979692 22 Left 924979678 2:208111-208133 CCTAAGTTGAAATCTACTCCCCA No data
Right 924979692 2:208156-208178 GTTGAGGAGGTGACGAGGTCTGG No data
924979677_924979692 29 Left 924979677 2:208104-208126 CCAAACTCCTAAGTTGAAATCTA No data
Right 924979692 2:208156-208178 GTTGAGGAGGTGACGAGGTCTGG No data
924979684_924979692 3 Left 924979684 2:208130-208152 CCCAGTTTGACGGGGTTAGGAGG No data
Right 924979692 2:208156-208178 GTTGAGGAGGTGACGAGGTCTGG No data
924979683_924979692 4 Left 924979683 2:208129-208151 CCCCAGTTTGACGGGGTTAGGAG No data
Right 924979692 2:208156-208178 GTTGAGGAGGTGACGAGGTCTGG No data
924979676_924979692 30 Left 924979676 2:208103-208125 CCCAAACTCCTAAGTTGAAATCT No data
Right 924979692 2:208156-208178 GTTGAGGAGGTGACGAGGTCTGG No data
924979686_924979692 2 Left 924979686 2:208131-208153 CCAGTTTGACGGGGTTAGGAGGG No data
Right 924979692 2:208156-208178 GTTGAGGAGGTGACGAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924979692 Original CRISPR GTTGAGGAGGTGACGAGGTC TGG Intergenic
No off target data available for this crispr