ID: 924981748

View in Genome Browser
Species Human (GRCh38)
Location 2:228991-229013
Sequence TAGAGGACTTTCAGAACAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924981748 Original CRISPR TAGAGGACTTTCAGAACAAG AGG (reversed) Intronic
905997172 1:42391324-42391346 TAGACGACTTGCACAAGAAGGGG + Intronic
909790257 1:79668376-79668398 TAGAGGATTTTAAGAAGAGGGGG - Intergenic
910977611 1:92923585-92923607 TATAAAACTTTCAGAACAAAGGG - Intronic
912993115 1:114509166-114509188 TGGAGGGCTTTCATATCAAGAGG - Intronic
913031276 1:114905526-114905548 TAGAGGACTTTCTGGAACAGGGG + Intronic
916260363 1:162835844-162835866 TAAAGAAATTTCAGAGCAAGGGG - Intronic
918284503 1:183038721-183038743 TCGAGGATTTTGAGAACATGTGG - Intronic
921611709 1:217219896-217219918 TAGAAGACTCTCAGAATAAATGG - Intergenic
1064211961 10:13367154-13367176 TACAGGAATTTCAGAGCAGGAGG - Intergenic
1067169932 10:43898239-43898261 TGGGGGACTTTCAGACCCAGAGG - Intergenic
1067455579 10:46417093-46417115 GAGAGTCCTTTCAGAAGAAGGGG + Intergenic
1067631624 10:47967546-47967568 GAGAGTCCTTTCAGAAGAAGGGG - Intergenic
1072544316 10:96422762-96422784 CAGAAGACATTCAGAGCAAGAGG + Intronic
1073833181 10:107410578-107410600 GAGAGGATTTTCAGAAGGAGAGG - Intergenic
1074227249 10:111496667-111496689 AAGAGGAGTTACAGAACAAGAGG + Intergenic
1075673195 10:124278195-124278217 CAGAGGCTGTTCAGAACAAGAGG + Intergenic
1075793510 10:125102842-125102864 TACAGGACTTGCAGAGCCAGTGG + Intronic
1078810201 11:14752856-14752878 TAGATAACTTTTAGAAGAAGTGG - Intronic
1079290333 11:19182684-19182706 TGGAGGCCTTACACAACAAGTGG - Exonic
1084043841 11:66557781-66557803 TAGAGGACTTTCGGGACTACCGG + Exonic
1084539852 11:69779235-69779257 TTTAGGACCTTCAGAATAAGGGG + Intergenic
1085155035 11:74285808-74285830 TAGAGAACTTGCAGAACCATGGG - Exonic
1086039894 11:82463465-82463487 TAGAGGAGTTTCTAAGCAAGGGG - Intergenic
1086436225 11:86783561-86783583 TGGAGGACTTTTAATACAAGAGG - Intergenic
1087235694 11:95716052-95716074 AAGAAGAATTTTAGAACAAGTGG + Intergenic
1087267719 11:96078994-96079016 TAAAGGACTTTCAGAATTACAGG - Intronic
1087806574 11:102561946-102561968 TAGTGGACTTTCATATCTAGAGG - Intergenic
1088977062 11:114825240-114825262 TAGAGGACCTTCAGAAAGGGGGG + Intergenic
1089216209 11:116836216-116836238 TGGACGACTTCCAGAAGAAGTGG - Exonic
1089501183 11:118932248-118932270 TAGAGGCCTCTCATAACAACTGG - Intronic
1094568778 12:31623942-31623964 TGGAGGACTTCCAGAGTAAGGGG - Intergenic
1097723817 12:63051795-63051817 AAAAGGAATTTCAGAAGAAGAGG + Intergenic
1099996420 12:89784333-89784355 TAGTGAAATTTCAGAAAAAGTGG + Intergenic
1100330635 12:93578638-93578660 TGGAAGACTTTCAGATCCAGAGG + Intronic
1100614731 12:96222194-96222216 TTGAGGACTTTCATGACAATAGG - Intronic
1103144064 12:118578960-118578982 CAGAGGAGTCTCAGAACCAGAGG - Intergenic
1105986168 13:25570014-25570036 TAGAGCACATTCATAACTAGTGG - Intronic
1106296947 13:28423036-28423058 TGGAGGACTGTAAGATCAAGCGG + Intronic
1107140403 13:36992710-36992732 TTGAGGCGTTTCAGACCAAGGGG - Intronic
1107790520 13:43997796-43997818 TAGGAGAATTTCAGAACTAGAGG + Intergenic
1109885278 13:68533804-68533826 TATATGACTTTCAGCACAATAGG + Intergenic
1110406288 13:75154074-75154096 CAGAGGATATTCAGAACAGGAGG - Intergenic
1111379955 13:87436624-87436646 TATAGGAGTCTCAGAAGAAGCGG + Intergenic
1111385875 13:87526673-87526695 TAAAGGAGGTTCAGAACAACTGG - Intergenic
1114006232 14:18316294-18316316 TAGAGGCCTGTCAGCACAATAGG + Intergenic
1114669864 14:24404174-24404196 CAGAGGACTTCCAGAAAGAGAGG - Intronic
1117656907 14:57964735-57964757 TAGAGGAGTCTCAGAACCACAGG + Intronic
1117790559 14:59336565-59336587 TAAAGGACTTTTAAAAGAAGTGG + Intronic
1118239305 14:64040378-64040400 TACAGTACTTTGAGAACAAAAGG + Intronic
1118340636 14:64894009-64894031 CAGAGGAGTCTCAGAACCAGAGG - Intergenic
1118969884 14:70626134-70626156 TAGAAGAATTTCAGAAGAATTGG - Intergenic
1119151264 14:72361761-72361783 CAGATGACTTTCACAATAAGAGG + Intronic
1119510060 14:75204002-75204024 TAGAGGACATTTAGAAAAAACGG - Intergenic
1122223556 14:100258458-100258480 TAGTGTTCTTTCTGAACAAGAGG + Intronic
1122355629 14:101121408-101121430 GAGAGGAAGTTCAGGACAAGGGG + Intergenic
1123167650 14:106341962-106341984 AGGAGGAATTACAGAACAAGAGG - Intergenic
1123170272 14:106366675-106366697 AGGAGGAATTACAGAACAAGAGG - Intergenic
1123903613 15:24900535-24900557 TAGGGGACTTTAAGAAAAATGGG - Intronic
1124442463 15:29697089-29697111 GAGAGGACTTTGAGGACATGGGG - Intergenic
1126057735 15:44747583-44747605 GATAGGAATTTCAGAAAAAGAGG + Intronic
1126648560 15:50898896-50898918 AAGAGGAATTTCAGTTCAAGAGG + Intergenic
1129026816 15:72583866-72583888 TATATGACTTTTAAAACAAGAGG + Exonic
1130912759 15:88282400-88282422 TACAGGACTTTAAGACCCAGTGG + Intergenic
1137321079 16:47383154-47383176 TAGAGGACTTTTTGAGAAAGGGG - Intronic
1138081288 16:54093627-54093649 TAGAGGAGTCTGGGAACAAGAGG - Intronic
1141084367 16:81081122-81081144 TAGAGAACTTTCAAAACTAAAGG + Intergenic
1142884746 17:2905622-2905644 TAGTGGAGTTTGGGAACAAGGGG + Intronic
1145178582 17:20723953-20723975 TACTGGACTGTCATAACAAGTGG - Intergenic
1145276846 17:21436732-21436754 AAGTGGGCTTTCAGGACAAGAGG + Intergenic
1145314680 17:21722625-21722647 AAGTGGGCTTTCAGGACAAGAGG + Intergenic
1146068292 17:29655560-29655582 TAGAGGACTTACAGAACCGAGGG - Exonic
1149838218 17:59933527-59933549 TACTGGACTGTCATAACAAGTGG - Intronic
1150081079 17:62239690-62239712 TACTGGACTGTCATAACAAGTGG + Intergenic
1153686991 18:7556263-7556285 CAGAGGACAATTAGAACAAGAGG + Intergenic
1155099948 18:22600986-22601008 AAGAGGACTTTGAGGACATGAGG - Intergenic
1155277356 18:24201391-24201413 TTCACAACTTTCAGAACAAGGGG - Intronic
1158763487 18:60419099-60419121 TGGAGGATTTTCAGAGCCAGTGG + Intergenic
1160006843 18:75074423-75074445 CAGAGGCCTTTCAGAACATGTGG + Intergenic
1164232619 19:23303535-23303557 TAGAGGACGTTCAGGACATTTGG - Intergenic
1164441591 19:28283860-28283882 AAGAGGACGATCAGAAAAAGAGG - Intergenic
1165494253 19:36142423-36142445 CAGAGGAATTTCACAAGAAGGGG - Intronic
1166824228 19:45599281-45599303 TGGAGGATTTTGAGGACAAGAGG + Intronic
924981748 2:228991-229013 TAGAGGACTTTCAGAACAAGAGG - Intronic
925705180 2:6677768-6677790 TAGAGGACTTCCAGAATCATGGG + Intergenic
930781742 2:55230612-55230634 TAGAGGTCTTGCAGATCAAGAGG + Intronic
931923478 2:67045485-67045507 CAGATGATTTTCAGAATAAGTGG - Intergenic
932127858 2:69160644-69160666 TAGGGGCACTTCAGAACAAGAGG + Intronic
932170693 2:69553063-69553085 TATAGAAATTTCAGAAAAAGGGG + Intronic
933989727 2:87625550-87625572 GAGAGGACTTGAAGCACAAGAGG - Intergenic
934168401 2:89318434-89318456 CAGAGGACTTTCATATTAAGAGG + Intergenic
934198886 2:89864148-89864170 CAGAGGACTTTCATATTAAGAGG - Intergenic
934764863 2:96875039-96875061 TAAAGGACTTTCAGGCTAAGTGG - Intergenic
935926671 2:108077343-108077365 TTGAGGACTTTCAGATGCAGAGG - Intergenic
936304117 2:111325276-111325298 GAGAGGACTTGAAGCACAAGAGG + Intergenic
938117241 2:128610331-128610353 TAGAGAACTTTCAGATAATGCGG - Intergenic
939112971 2:138030045-138030067 TAAAGGACATTCAGGAAAAGAGG - Intergenic
939325322 2:140680387-140680409 TATTGGACTTTGAGAAAAAGCGG + Intronic
940935174 2:159485277-159485299 TAAAGGACATTCAGAAATAGGGG + Intronic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
942569516 2:177299106-177299128 CAGAGGATTTTTAGAACAAAGGG + Intronic
942981463 2:182088371-182088393 TAGAAGATTTTCACAGCAAGAGG - Intronic
943349060 2:186775993-186776015 TGGAGGACTTTCAGAAGGATTGG - Intergenic
943608078 2:189999766-189999788 AAGAGGACTATGAGAACATGTGG - Intronic
944451025 2:199842452-199842474 TTGAGGACTTTTAGAATAAAGGG - Intronic
945681641 2:212921050-212921072 AGGAAGACTTTAAGAACAAGGGG - Intergenic
1168976945 20:1973926-1973948 TGGAGGATTTTCAGCACAGGAGG - Intergenic
1172218556 20:33254646-33254668 CATAGGAATTCCAGAACAAGAGG + Intergenic
1173555865 20:43965145-43965167 AGGAGGACTTTCAGAGCAGGAGG + Intronic
1174337950 20:49876799-49876821 TAGAAGACATTCAGATCTAGTGG - Intronic
1177457417 21:21358796-21358818 TGGAAGACTTACAGAATAAGGGG - Intronic
1179336764 21:40463894-40463916 GAGAGGAATTTCAGAAAAGGAGG - Intronic
1180430743 22:15247107-15247129 TAGAGGCCTGTCAGCACAATAGG + Intergenic
1180728260 22:17962003-17962025 TATAGGACTTACAGAAAAATGGG + Intronic
1182636836 22:31734622-31734644 TAGAGGTCATTCAGCAGAAGTGG - Intronic
1183100719 22:35582297-35582319 CAGAGGACTCTCTGAACACGGGG + Intergenic
954202640 3:49033239-49033261 TAGAGTACTGTCACAACAAGAGG + Intronic
954640112 3:52092864-52092886 AAGAGGCCTTTCAGATGAAGAGG - Intronic
957215998 3:77320195-77320217 GAGAGGAGTTTTAAAACAAGAGG - Intronic
957682678 3:83457918-83457940 TAGAGGAAGTTGAGAAAAAGTGG - Intergenic
958023570 3:88025194-88025216 CAGAGGAGTTTCAGATTAAGAGG + Intergenic
959674030 3:109014138-109014160 TAGAAGACTTTCAGAAAATGGGG + Intronic
959966034 3:112356242-112356264 TAAAGGACTTTCAAAACACAAGG - Intronic
960194256 3:114746029-114746051 TAGTTAACTTTTAGAACAAGGGG - Intronic
961269083 3:125674207-125674229 CAGAGGACTTTCAGATGCAGAGG + Intergenic
962698549 3:137974602-137974624 TAGAGGACAGACAGAGCAAGAGG - Intergenic
968580718 4:1392566-1392588 TAGAGGACTGAAAGAAAAAGAGG - Exonic
970140933 4:12981404-12981426 TAAAGGACTTACAGAGCAAATGG + Intergenic
973645430 4:52946359-52946381 TAGAGTACTTTCAGAAGGATAGG + Intronic
973666063 4:53160512-53160534 TAGAGGAGGTTCAGAAAAGGAGG + Intronic
974339428 4:60595812-60595834 TATAGGACTTACAGAATAATTGG - Intergenic
974798846 4:66788516-66788538 TAAAGTACTTTCAGAATATGCGG - Intergenic
974847439 4:67367844-67367866 TGGTGTACTTTCAGACCAAGGGG + Intergenic
976227211 4:82804983-82805005 GAGGTGACTTTAAGAACAAGAGG + Intergenic
980161090 4:129163817-129163839 TAGAGGACTGAGAGAAAAAGAGG - Intergenic
981455537 4:144948978-144949000 TAGAGGAATTTAAGATAAAGTGG + Intergenic
981890894 4:149735678-149735700 TAAAGGACTTTCAGAACTGAAGG - Intergenic
982720028 4:158849569-158849591 TAGGGGACTTTAGGAACTAGGGG + Intronic
984180672 4:176478997-176479019 TGGAGGACTCTCTGAGCAAGAGG - Intergenic
984558954 4:181245657-181245679 AAGAGGATTTTCATTACAAGTGG + Intergenic
985939954 5:3127453-3127475 TAGAAAACTTTCAGAACAACAGG + Intergenic
989148805 5:38277001-38277023 TAGAGGAGTTTGAGAAAAATAGG - Intronic
989254268 5:39349850-39349872 TCAAGGACTATCAGAAGAAGAGG - Intronic
990401077 5:55438068-55438090 TACAGGAATTTCATAACAGGCGG + Intronic
992331518 5:75721634-75721656 TAGAGGAGGTTCAGAACTTGGGG - Intergenic
995808354 5:116079174-116079196 TAGTGGAGTCTCAAAACAAGAGG - Intergenic
996973704 5:129404667-129404689 TAGAGTACCTTCAAAATAAGTGG + Intergenic
997735893 5:136212491-136212513 TAAAGGAAATGCAGAACAAGTGG - Intergenic
998627600 5:143863320-143863342 TGTAGGACTTTCAGTAGAAGAGG - Intergenic
999592886 5:153168103-153168125 TACAGCACTTTGAGAACCAGTGG + Intergenic
1000312553 5:160059145-160059167 TATAGGACTTTCAAAGCAACAGG - Intronic
1004511844 6:16289636-16289658 TAGACGACTTCCATAACACGGGG + Intronic
1006566201 6:34959906-34959928 GGGAGCACTTTCAAAACAAGGGG - Intronic
1007872025 6:45051195-45051217 TATGGGAGTTTAAGAACAAGTGG + Intronic
1008141889 6:47841361-47841383 CAGAGGAATTTCACACCAAGAGG - Intergenic
1010049027 6:71481816-71481838 TAGAGGATTTTGAGCACCAGAGG - Intergenic
1010135787 6:72551533-72551555 TAGAGCAGTATCAGAACAAGTGG + Intergenic
1010972249 6:82275376-82275398 TAGAGGGTTTTCAGAAAAATAGG + Intergenic
1011297978 6:85844098-85844120 TAGAATACTTTCAGAAGGAGTGG + Intergenic
1011861055 6:91757072-91757094 TAAAGGACTTTCAGAAACAGGGG + Intergenic
1012156827 6:95829291-95829313 TTGAGGACTTTCAAGTCAAGTGG + Intergenic
1018332035 6:162740214-162740236 TATAGGAATTTTAGAATAAGCGG + Intronic
1019070020 6:169337833-169337855 CAGAGGACTTTCAGCAGAAATGG + Intergenic
1019222024 6:170480447-170480469 TGGAGGTCTTCCAGAATAAGTGG - Intergenic
1019793413 7:3032370-3032392 TAGATGACTTTTAAAGCAAGAGG + Intronic
1021060147 7:16101206-16101228 TAGAAGAGTTTCAGAATAAATGG + Intronic
1021277052 7:18664509-18664531 TAGTGGAGTTTGAGAACCAGAGG - Intronic
1022157975 7:27679375-27679397 TCCAGGACTTTCAGCACCAGAGG - Intergenic
1022602629 7:31776127-31776149 TGGAGGACTATCTGAAGAAGGGG + Intronic
1023199800 7:37684265-37684287 TAAAGGATTTTCATAACAAAAGG - Intronic
1024799610 7:53060999-53061021 CAGAGGACGTGAAGAACAAGTGG + Intergenic
1027678685 7:81191148-81191170 GAGAGGACTGTCAGCAAAAGAGG + Intronic
1030266788 7:107629620-107629642 TAAATGACTTTCAGAGAAAGTGG + Intergenic
1030717458 7:112826598-112826620 TAGAAAACTTTCAGAAAAATAGG - Intronic
1032515565 7:132503871-132503893 AAGAGGTCTCCCAGAACAAGTGG - Intronic
1034211104 7:149364006-149364028 TAGAGGAATTGCAGACCTAGTGG - Intergenic
1036485532 8:9175527-9175549 GAGAGGACTAACAGAACAAGAGG + Intergenic
1037256385 8:16960139-16960161 TGGCGGACTTCAAGAACAAGAGG - Intergenic
1038166409 8:25088908-25088930 TAGTGGAGTCACAGAACAAGGGG + Intergenic
1038523591 8:28254477-28254499 AAGAGGACTTGGAGAAGAAGAGG - Intergenic
1040895260 8:52361448-52361470 GAAAGGACATTCAAAACAAGGGG + Intronic
1046688288 8:117252125-117252147 TAGAGAAATTTCAGAACACTGGG - Intergenic
1046814423 8:118568450-118568472 TAGAGGATTTTGAGCAGAAGAGG + Intronic
1048878659 8:138856044-138856066 TGGGGGACTTGCAGAAAAAGGGG + Intronic
1049416460 8:142497732-142497754 AAGAGGACATTCAGAGAAAGGGG - Intronic
1050000585 9:1073173-1073195 TGAAGGACTTACAGTACAAGGGG - Intergenic
1050909316 9:11047167-11047189 GAGAGGACTTACTGTACAAGTGG - Intergenic
1051142194 9:13989482-13989504 TATAGAACTTTCAGGAAAAGAGG + Intergenic
1053261758 9:36672266-36672288 CAGAGAAATTTCAGAACAAAAGG - Intronic
1055665915 9:78553000-78553022 ATGAGGAATTACAGAACAAGTGG + Intergenic
1055877039 9:80955534-80955556 GAGAGGAGTTTGAGAAAAAGTGG - Intergenic
1056124744 9:83524104-83524126 TAGAGGACTTTTAGAAAAATAGG - Intronic
1057081303 9:92176498-92176520 TAGAGTGCTTTCAAAACATGAGG - Intergenic
1057968139 9:99524745-99524767 TATAGGTGTTCCAGAACAAGAGG - Intergenic
1186594963 X:10971048-10971070 TTGTGGACTTGCAGAACCAGTGG - Intergenic
1188658085 X:32723470-32723492 TAGAAGATTTTAAGAACAAATGG + Intronic
1188790219 X:34399471-34399493 TAGAATACTTTCAGAAGAAGAGG + Intergenic
1190977439 X:55419811-55419833 TAGAAGAGTTTCAAAAGAAGTGG - Intergenic
1192085928 X:68097340-68097362 AAGAGGACATTCAAAGCAAGAGG + Intronic
1194751461 X:97689378-97689400 TTAAGGAGTTTCAGAAAAAGAGG + Intergenic
1195657061 X:107341941-107341963 TAGAGGACATTGAGAAGGAGTGG - Intergenic
1196768536 X:119271438-119271460 TGGAGCACTTGCAGAAGAAGAGG - Intergenic
1198366995 X:135951159-135951181 TATAGAACTTTCAGCACTAGTGG - Intergenic
1199480302 X:148291152-148291174 CAAAGGACTCTCAGAACAAATGG - Intergenic