ID: 924982964

View in Genome Browser
Species Human (GRCh38)
Location 2:239984-240006
Sequence CCTTCCCCCAGCCCCTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 675
Summary {0: 1, 1: 0, 2: 6, 3: 67, 4: 601}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924982961_924982964 13 Left 924982961 2:239948-239970 CCTCTTGGGGAAGGGGGTTTGCA 0: 1
1: 0
2: 2
3: 23
4: 177
Right 924982964 2:239984-240006 CCTTCCCCCAGCCCCTGGTCAGG 0: 1
1: 0
2: 6
3: 67
4: 601
924982955_924982964 26 Left 924982955 2:239935-239957 CCTGATGGAAGCTCCTCTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 924982964 2:239984-240006 CCTTCCCCCAGCCCCTGGTCAGG 0: 1
1: 0
2: 6
3: 67
4: 601

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924982964 Original CRISPR CCTTCCCCCAGCCCCTGGTC AGG Intronic
900105319 1:978604-978626 CCCTCCCCCAGCCTCTGGCAGGG - Intronic
900148227 1:1167458-1167480 CCTGCCCACAGCGCCTGGGCGGG + Intergenic
900189234 1:1346286-1346308 CCATCCCCCAGTCCCAGGCCTGG + Intronic
900354053 1:2251421-2251443 CCCTGCCCCAGCCCCTGCTGAGG + Intronic
900400396 1:2470668-2470690 CCTGCCCCCAGCCCATAGCCAGG - Intronic
900516802 1:3085977-3085999 CCTGACCCCATGCCCTGGTCTGG + Intronic
900630651 1:3633429-3633451 CCTTCCCGCCGCCCCGGGCCGGG - Exonic
900656759 1:3762476-3762498 ACATCCCCCAGCCCCTTGGCAGG + Intronic
901004118 1:6163436-6163458 CCCTCGGCCAGCCCCTGGTAGGG - Intronic
901050968 1:6425683-6425705 CCTTCCCCCACACCCTGGCTGGG - Intronic
901207182 1:7503929-7503951 CCCTCCCCCAGCCCTTCCTCTGG - Intronic
901316795 1:8315134-8315156 CCTTCCCCCACACCCAGGACCGG + Intergenic
901431276 1:9216454-9216476 CCCACCCCCAGCTCCTGGTGGGG - Intergenic
901513423 1:9729841-9729863 CCCCGCCCCAGCCCCTGCTCAGG - Exonic
901680601 1:10910500-10910522 CGTTACACCAGCCCCTGCTCGGG + Intergenic
901782461 1:11602854-11602876 CCTTCCCCCATCACATGGTGGGG - Intergenic
902273470 1:15323275-15323297 CCCGCCCCCAGCCCCAGCTCTGG - Intronic
902580541 1:17404920-17404942 CCATCCCCCAGCCACAGGCCTGG + Intergenic
902700645 1:18169620-18169642 CCTGCCCCCAGCCCAGGGTAGGG + Intronic
902703634 1:18189989-18190011 CCATCCCCCAGGCCATGGACTGG - Intronic
902995866 1:20224174-20224196 CTTTCCCTCAGTCCGTGGTCTGG + Intergenic
903221349 1:21871195-21871217 CTTTCCACCAGACCCTGTTCTGG + Intronic
903297075 1:22350723-22350745 CCCTCCCCCATCCCTTGGCCAGG - Intergenic
903373644 1:22852572-22852594 ATTGCCCCCAGCCCCAGGTCTGG - Intronic
903564401 1:24253847-24253869 CCTTCCCGCAAGCCTTGGTCGGG - Intergenic
904309729 1:29621001-29621023 CCTTCCCCCACTCTGTGGTCTGG + Intergenic
904360902 1:29971212-29971234 TCTTCCCCCATCCCAGGGTCAGG + Intergenic
904546089 1:31273928-31273950 CCTTCTTCCAGACCCTGCTCAGG - Intronic
904618649 1:31763041-31763063 CCCTCCCGCAGCCCCAGGGCCGG - Intronic
904690921 1:32292649-32292671 CCCTCCCCCAGCCTCTGAGCGGG + Intronic
905451538 1:38060171-38060193 CCTGCCCCCAGTCCCTTGGCTGG - Intergenic
907457573 1:54585343-54585365 CCTGCCCCCAGGCCTGGGTCAGG - Intronic
907581072 1:55573212-55573234 CCAGGCCCCAGCCCCTGCTCTGG - Intergenic
908555758 1:65254938-65254960 CCGGCCCCCAGCACCTGGCCTGG + Intronic
908624077 1:66020463-66020485 CCTCCCCCCACCCCATGGACAGG + Intronic
910229737 1:84973931-84973953 CCTTCCCCCAGCCCCAGCAGTGG + Intronic
911241302 1:95470606-95470628 AGTTCCCCCAGGCCCTGGGCGGG + Intergenic
911935235 1:103961086-103961108 CCTGCTCCCAGCACCTGCTCTGG - Intergenic
912498868 1:110108655-110108677 CCTGCACGCAGCCGCTGGTCTGG + Intergenic
912890681 1:113526401-113526423 TCTTCCCCTAACCCCTTGTCTGG - Intronic
913170242 1:116225439-116225461 CCTTTCCCCTTCCCATGGTCTGG + Intergenic
913592354 1:120341510-120341532 CCTCCCCCCACCCCCAAGTCTGG - Intergenic
913651005 1:120913635-120913657 CCTCCCCCCACCCCCAAGTCTGG + Intergenic
914170109 1:145215432-145215454 CCTCCCCCCACCCCCAAGTCTGG - Intergenic
914525226 1:148459395-148459417 CCTCCCCCCACCCCCAAGTCTGG - Intergenic
914598450 1:149176435-149176457 CCTCCCCCCACCCCCAAGTCTGG + Intergenic
915025519 1:152826124-152826146 CCTTCCCTCCTGCCCTGGTCTGG - Intergenic
915319911 1:155051060-155051082 CCTTCACCCGGCGCCAGGTCCGG - Intronic
915486369 1:156223796-156223818 CCTTCCCCGAGCCCCTGCTAAGG + Intronic
915907790 1:159891643-159891665 CCATCCCCCTGCCTCTGGTCAGG - Intronic
916714000 1:167434920-167434942 CCTTCCTCCAGCCCTTCCTCCGG + Intronic
916714022 1:167434982-167435004 CCTTCCTCCAGCCCTTCCTCCGG + Intronic
916714035 1:167435019-167435041 CCTTCCTCCAGCCCTTCCTCCGG + Intronic
916714048 1:167435056-167435078 CCTTCCTCCAGCCCTTCCTCCGG + Intronic
916714074 1:167435130-167435152 CCTTCCTCCAGCCCTTCCTCCGG + Intronic
916714087 1:167435167-167435189 CCTTCCTCCAGCCCTTCCTCCGG + Intronic
916714100 1:167435204-167435226 CCTTCCTCCAGCCCTTCCTCCGG + Intronic
916714113 1:167435241-167435263 CCTTCCTCCAGCCCTTCCTCCGG + Intronic
916714126 1:167435278-167435300 CCTTCCTCCAGCCCTTCCTCTGG + Intronic
916714138 1:167435315-167435337 CCTTCCTCCAGCCCTTCCTCTGG + Intronic
917597470 1:176543652-176543674 CCTTCCACCATCCCCAGGTGTGG - Intronic
917729056 1:177855960-177855982 CCTTGCCCCAGGCCCAGGGCTGG - Intergenic
917790665 1:178496832-178496854 CCTTCCCTCAGCCTCTAGCCCGG + Intergenic
917958870 1:180126725-180126747 CATTTCCCCAGCCTCTGGCCTGG + Intergenic
918384666 1:183993614-183993636 TCCTTCCCCAGCCCCAGGTCAGG + Intronic
919021693 1:192114354-192114376 CCTTCTCACTGTCCCTGGTCTGG + Intergenic
919464897 1:197915406-197915428 GCTGCCCCCAGCCCCTCCTCAGG + Intronic
919914230 1:202130091-202130113 ACTTCCCCCAGCCCCACCTCTGG + Exonic
920244501 1:204577528-204577550 CCCTGCCCCACCCTCTGGTCTGG - Intergenic
920409619 1:205749493-205749515 CCTTCCCCCAGCGACTGGCGCGG - Intronic
922163702 1:223097408-223097430 CGCTCCCCCAGCCCCTGATGGGG - Intergenic
922324125 1:224512733-224512755 CCTTCCTCCAGCCCCTGAGGTGG + Intronic
922388674 1:225114836-225114858 CCTTCCCCCACCCCCTGTGGTGG - Intronic
922526500 1:226308688-226308710 CCCTCCCCCGGCCCCGGGACAGG + Intronic
922743838 1:228031971-228031993 CCTTCCTCCATCACCTGGTATGG - Intronic
922758547 1:228109809-228109831 CCTTCCCTCAGCCCCCGCCCGGG - Intergenic
922804312 1:228377738-228377760 CCTGCCCCCCGCCCCAGGTGAGG - Intronic
923720642 1:236463972-236463994 CCTTCTCCAAACCCCCGGTCTGG - Intronic
1062823160 10:549666-549688 GCTGCCTCCAGCACCTGGTCGGG - Intronic
1062858969 10:794888-794910 CCCTCCCCCACCCCCTGGTAGGG - Intergenic
1062878955 10:963093-963115 CCTTCCTCCAGCCTGTGGCCAGG + Intergenic
1062972398 10:1659349-1659371 CCTTCCCCCAGCTCATAGACAGG - Intronic
1063131470 10:3181546-3181568 CCTTCCTCCATCCCCTGATACGG - Intergenic
1063268623 10:4482363-4482385 CCTTCCTCCAGCACCTGATATGG - Intergenic
1063956643 10:11273459-11273481 CTTCCCCTCAACCCCTGGTCTGG + Intronic
1065152595 10:22837539-22837561 ACTTCCCCCGCCCCGTGGTCTGG + Intergenic
1066649644 10:37642451-37642473 AGTTCCCCCAGGCCCTGGGCAGG + Intergenic
1067238728 10:44472780-44472802 CTCTCCCCCAGCCCCTGGTGTGG + Intergenic
1067793508 10:49304731-49304753 CCTTTCTCCAGCCCCTGGGAAGG - Intronic
1067944235 10:50680249-50680271 CCTTCCCCCAGCCCCATGTGAGG - Intergenic
1068686251 10:59872774-59872796 CCTTCCCCCACCCCCCCATCTGG - Intronic
1069750798 10:70743975-70743997 CCCATCCCCAGGCCCTGGTCAGG - Intronic
1070554244 10:77515812-77515834 CCTCCCTCCAGCCCCTGGGCTGG + Intronic
1071420508 10:85492642-85492664 CCTTCCAGCAGCCCCTCCTCAGG - Intergenic
1071646079 10:87361558-87361580 CCTTCCCCCGGCCCCATGTGAGG - Intronic
1072521777 10:96236018-96236040 CATTCCCAGACCCCCTGGTCTGG - Intronic
1072637104 10:97185392-97185414 CCTGCCCCCACCCCCAAGTCCGG + Intronic
1073053400 10:100683951-100683973 CCCTCCCCCCGTCCCTAGTCTGG - Intergenic
1073136602 10:101223858-101223880 CCTTCCCCCCGCCGCAGCTCTGG + Intergenic
1074055962 10:109923234-109923256 CCTTCCCCCGGCTCCTGTTCCGG + Intronic
1074278085 10:112023919-112023941 CCGTCAGCCAGGCCCTGGTCTGG - Intergenic
1074545239 10:114397258-114397280 CCTTCCCCCAGTCCCAGTCCTGG + Intronic
1075099082 10:119493306-119493328 GCTTCCTCCAGACCCTGGTGTGG - Intergenic
1075124262 10:119687114-119687136 CCTTCCCCCACCCCACAGTCTGG - Intergenic
1075132168 10:119749111-119749133 CCTGCTCCCAGCACCTGCTCTGG - Intronic
1075269556 10:121036641-121036663 CCTACCCCCAGCCCCTCCTAGGG - Intergenic
1075341913 10:121653737-121653759 TCTTCCCCCAGCTCCTGCTATGG - Intergenic
1076058236 10:127392744-127392766 CCCACCCCCAGCGCCGGGTCGGG + Intronic
1076601854 10:131662331-131662353 CCGTCCCCCAGCCCCATGACAGG - Intergenic
1076642643 10:131929232-131929254 CCTCCTCCCAGCCACTGGGCAGG + Intronic
1076857584 10:133124825-133124847 CCTTCCCCCGGCCCCGGCCCCGG + Intronic
1077229749 11:1453468-1453490 CCTTACCCCAGCCCCATGCCAGG - Intronic
1077341044 11:2026455-2026477 CTTGTCCCCAGCCCCTGCTCAGG - Intergenic
1077483109 11:2825810-2825832 CCTTGCCCCAGTCCCTGGCGTGG - Intronic
1078068532 11:8093713-8093735 CATTCTCCCTGCCCCTGTTCAGG + Intronic
1078379129 11:10823985-10824007 CCTGCCCCCTGCCCCTACTCTGG - Intronic
1078982320 11:16550309-16550331 CCTTCCCCCAACCCCAAGACAGG - Intronic
1079599674 11:22295482-22295504 CCTTCCCTCAGCCCAGTGTCAGG - Intergenic
1080175245 11:29355573-29355595 CCTTCCCCCAACCCCATGACAGG + Intergenic
1080489977 11:32751644-32751666 CCCTCCCCCAGCCCCTGCAGTGG - Intronic
1080810186 11:35696521-35696543 CTTTCCCCCAGCCCCTTTTTTGG + Intronic
1081537311 11:44005208-44005230 CCTGCCCCCAGCCCCCTGCCTGG + Intergenic
1081651036 11:44824370-44824392 CCTGCCCCCAGCCCCAGTTGGGG - Intronic
1081862089 11:46339089-46339111 CCTGCCCCCAGCCCCTCTGCAGG - Intronic
1082006749 11:47423495-47423517 ACTGCTCCCAGCCCCTGGCCCGG - Intronic
1082821599 11:57547816-57547838 CCTTCCCACAGCTCCCAGTCTGG + Intronic
1083039894 11:59675826-59675848 CCTTCCCCCAGGCCATGGGTTGG - Intergenic
1083254643 11:61488694-61488716 CCCTGCCCCACCCCCTGCTCCGG + Intronic
1083304291 11:61754634-61754656 CCACCCCCCAACCCATGGTCAGG - Intronic
1083484432 11:62974533-62974555 CATTCCCCTAGCTCCTGGCCTGG - Intronic
1083579231 11:63814027-63814049 CCTTTCCCCCGCCCAGGGTCTGG + Intronic
1083640049 11:64140507-64140529 CCTGCACCCAGCCCTTGGTGGGG - Intronic
1083889894 11:65590443-65590465 CCTGCCCCCTGCCCCGTGTCAGG - Intronic
1083926801 11:65812233-65812255 CCTACTTCCAGCCCCTGTTCTGG - Intergenic
1083947023 11:65929351-65929373 CCTCCCCACAGCCATTGGTCAGG + Intergenic
1084031621 11:66484633-66484655 CCTTCCCCCAGCTCCAGGGGTGG - Intronic
1084331225 11:68431857-68431879 CCATCCACCACCCCCTGGCCTGG + Intronic
1084562296 11:69911748-69911770 CCCGCGCCCAGCCCCAGGTCCGG - Intergenic
1084571893 11:69964944-69964966 GCTGCCCCCAGCCCCTGGAGGGG + Intergenic
1085130486 11:74033834-74033856 CCTTCCCTCTGCACCTCGTCAGG + Exonic
1085276379 11:75302813-75302835 CCTGCCCCCACCCCCTGCTCAGG + Intronic
1085280233 11:75325260-75325282 CCTCACCCCAGCCCCTACTCTGG + Intronic
1085298108 11:75442357-75442379 GCTTCCCCCAGCACCAGGTGAGG - Exonic
1085380730 11:76115570-76115592 TCTACCCCCAGACCCTGGTAGGG - Intronic
1085476010 11:76789265-76789287 CCTGTCCCCAGCCCCTCATCTGG - Intronic
1085839885 11:79999479-79999501 CTTTCCCCCAACCCCTGGACAGG - Intergenic
1086453394 11:86938721-86938743 CCTACCCCCAGCCCCTCGGAAGG - Intronic
1087565374 11:99849487-99849509 CCTGCTCCCAACCCCTTGTCAGG + Intronic
1088400937 11:109422386-109422408 CCTGCCCCCGGCCCCTGCCCTGG + Intronic
1088884334 11:113995091-113995113 TCCTCCCCCAGCTCCTGCTCCGG - Intergenic
1088884503 11:113996478-113996500 CCCTCCCCTAGCTCCTGCTCTGG - Intergenic
1088914976 11:114220628-114220650 GCATCCACCAGCACCTGGTCTGG - Intronic
1089255593 11:117192375-117192397 CCCTCCCCCAGGCCCTGCCCCGG - Intronic
1089286718 11:117412172-117412194 GCTGCCCCAAGCCCCTGCTCAGG - Exonic
1089298552 11:117484034-117484056 CCTGCCCCCCGCCCCTGCCCCGG + Intronic
1089352260 11:117828397-117828419 TCTTCCCCAGGCCCCTGGGCTGG + Intronic
1089556923 11:119320169-119320191 CCTTCCTCCTGCCCTGGGTCAGG - Intronic
1089563273 11:119356666-119356688 CCTTGCTCCAGACCCTGATCAGG + Exonic
1089688236 11:120170216-120170238 CCCTCCCCCAGCCCCGCCTCTGG - Exonic
1089695661 11:120214859-120214881 CCTTCACTCAGCCTCTGGGCAGG - Intronic
1090119931 11:124015616-124015638 CCTTCCCCATGCCCCAGGGCTGG + Exonic
1090120576 11:124023054-124023076 CCTTCCCCATGCCCCAGGGCTGG + Exonic
1090121938 11:124038938-124038960 CCTTCCCCATGCCCCAGGGCTGG - Exonic
1091271218 11:134313121-134313143 CCTGTCCTCAGCCCCTGGTTGGG + Intronic
1202824029 11_KI270721v1_random:81644-81666 CTTGTCCCCAGCCCCTGCTCAGG - Intergenic
1091389034 12:114358-114380 CCTTGCCAGAGCCCCTGGTATGG - Intronic
1092099559 12:5871932-5871954 CCTTCCCACAGCACATGCTCAGG + Intronic
1094819173 12:34211415-34211437 CCTTCCAGCAGCCCCTGCGCTGG - Intergenic
1094838010 12:34331236-34331258 CTTCCCCCCAGCCCCTGCACAGG - Intergenic
1095118553 12:38385374-38385396 CCCTCCCCCAGCTTCTGGCCGGG + Intergenic
1095158407 12:38886766-38886788 CCTTCCACCAGACCCTGGCTGGG - Intronic
1095631827 12:44385657-44385679 TCTTCCCCCACCATCTGGTCTGG + Intronic
1095694903 12:45133035-45133057 CCTTCCCCCAGTCCCTGACTGGG - Intergenic
1095946754 12:47758205-47758227 CCTCCCCCCAGCTCCTGGCAGGG - Intronic
1096127519 12:49130819-49130841 CCTTCCCGCCGCTCCTGGGCGGG - Intronic
1096231740 12:49900577-49900599 CCTTCCCCGAGCCCGTGCTGGGG - Intronic
1096461726 12:51825382-51825404 CCTCTCACCAGCCCCTGGCCTGG + Intergenic
1096606138 12:52767906-52767928 CCTTCCTCCAGCCTCTGAGCAGG - Intergenic
1096678878 12:53241884-53241906 CCTTCACCCAGCCCCCAGCCTGG + Intergenic
1096693892 12:53336846-53336868 CCTTCCTCCAGGCCTTGCTCTGG - Intronic
1098864802 12:75749363-75749385 CCTTCCCCCAACCCCATGACAGG - Intergenic
1099973593 12:89524921-89524943 CCGGCCCCCAGCCCCCGGCCCGG - Intronic
1101508352 12:105369607-105369629 CTTTCCCCCAACCCCTGAACAGG + Intronic
1101613226 12:106310889-106310911 CCTTCCCCCAGCACCTTGGCCGG - Intronic
1102279477 12:111607681-111607703 CCATCCCCCAGCCTCTGGGGAGG + Intergenic
1102492500 12:113297598-113297620 CCTTCCCCCCTTCCCAGGTCAGG + Exonic
1102500264 12:113347178-113347200 CCTTTCCCCAGCCCCTGTCCAGG - Intronic
1102800416 12:115727835-115727857 CCTTCCCCCACCCCCTCCCCTGG - Intergenic
1102938974 12:116921607-116921629 CCTCCCCCTAGCACCTGGTGTGG + Intronic
1103212391 12:119176401-119176423 CCTCACCCCAGCCCCTGCCCAGG + Intergenic
1103446315 12:120997369-120997391 CCTTCCCAGAGCCCGTGGTTTGG - Intronic
1103506103 12:121443123-121443145 CCTCCCTCCAGCCCCTCCTCTGG - Intronic
1103883722 12:124185924-124185946 CCCTGCCCCTGCCCCAGGTCTGG + Intronic
1103981258 12:124738371-124738393 CCGTCCCCAGGCCCCTGCTCAGG + Intergenic
1103982574 12:124746146-124746168 CCCTCCCCCAGCCTCCGCTCTGG + Intergenic
1104502159 12:129296779-129296801 CCTTTCCCCAATCCCTGCTCTGG - Intronic
1104937589 12:132374850-132374872 CCCTCCCTCAGCGCCTGGGCTGG + Intergenic
1105350607 13:19611898-19611920 CCTTCCCCCAACCCCATGACAGG + Intergenic
1105520545 13:21127139-21127161 CCCTGCTCCAGCCCCTGGCCTGG + Intergenic
1105734869 13:23257409-23257431 CATTCCCCCACCCCATGGACAGG + Intronic
1105846810 13:24300610-24300632 CCTTCACCTGGCCCCTGTTCTGG - Intronic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106722144 13:32446110-32446132 CCTACCCCCAGCCACTAGCCTGG + Intronic
1107421729 13:40253779-40253801 CCAACCCCCAACCCCTGGTGTGG + Intergenic
1107451279 13:40512372-40512394 CCTTCCCCCTGCCCCCGGACAGG - Intergenic
1107470845 13:40689782-40689804 CCTGCCCACAGCCCCTGCTCTGG + Intergenic
1108194079 13:47973932-47973954 CCTTGCCCCAGCCCCCTGACAGG - Intronic
1108547428 13:51509864-51509886 CCTTCCCCCAACCCCATGACAGG + Intergenic
1108571136 13:51752543-51752565 CCTTCTCCCCTCCCCTGGTTTGG - Intronic
1110659865 13:78047783-78047805 CCCTCCCCCAACCCCAGGACAGG + Intergenic
1111367733 13:87271391-87271413 CCCTCCCCCAACCCCAGGACAGG - Intergenic
1113748903 13:112765149-112765171 CCTCCCCCCCGCCCCGGCTCTGG + Intronic
1113798174 13:113071039-113071061 CCTTTCCCCAGCACGTGGTGGGG + Intronic
1115399794 14:32943483-32943505 CCCTGCCCCAGATCCTGGTCTGG + Intronic
1115644211 14:35356116-35356138 CCTGCCCCCAGCCCTGGTTCTGG - Intergenic
1116190109 14:41654041-41654063 CCTTCCCCCAACCCCACGACAGG - Intronic
1117722212 14:58638581-58638603 CCGACCTCCAGCCCCTGGGCAGG - Intronic
1117736670 14:58775049-58775071 CCTTCTCCCATCCCCTAGTCTGG + Intergenic
1118316560 14:64729545-64729567 CCCTGACACAGCCCCTGGTCAGG - Intronic
1119618330 14:76112988-76113010 CCTTCCCCCAGCTCCAGGCCCGG - Intergenic
1121127569 14:91417863-91417885 CCTTCCCCCAGACCCGGGCGGGG - Intergenic
1121524192 14:94607179-94607201 CCTTCTCCCAGCCTCTTTTCTGG - Intronic
1122070279 14:99201555-99201577 CCTGCCCCCAGTCCCTGTCCTGG + Intronic
1122278919 14:100609974-100609996 CCCTCCCCCAGCCCTGGGGCAGG - Intergenic
1122637681 14:103138081-103138103 CCCTCCCCCACCCCCAGCTCCGG - Intergenic
1122829841 14:104390449-104390471 TCTTCCCCGAGCCCCTGGCAAGG - Intergenic
1123030197 14:105447956-105447978 CCTCCACCCAGCCCCTGCTGGGG + Intronic
1123083955 14:105708934-105708956 CCTGACCGCAGCCCCTGCTCTGG + Intergenic
1124477274 15:30045627-30045649 GCTTCCCCCCGGCCCGGGTCCGG + Intergenic
1124554128 15:30709591-30709613 CCTTCCCCAACCCCCTGCTCAGG + Intronic
1124677118 15:31696080-31696102 CCTTCCCCAACCCCCTGCACAGG - Intronic
1124966373 15:34435982-34436004 CCTTCCCCCACAGCCTGGGCTGG - Intronic
1125028107 15:35050860-35050882 CCTTCCCCCAGACCTAGGTATGG + Intergenic
1125534534 15:40435854-40435876 CCTCACCCCAGCCCCTTGCCAGG + Intronic
1125535028 15:40437666-40437688 CCTCCCTCCAGCCCCTGCCCAGG - Intergenic
1125541080 15:40470678-40470700 CCTTCCTCCAGCAACGGGTCTGG - Intergenic
1125720371 15:41842375-41842397 CCTGGCCCCAGCACCTGCTCAGG - Intronic
1126419675 15:48458024-48458046 CCTTCCATCAGCCCCTTGGCTGG + Intronic
1127970216 15:63952934-63952956 CCTTCCCCCCACCCCTGGCCTGG + Intronic
1129169249 15:73797817-73797839 CACTCCCCCAGCCCCTGACCCGG - Intergenic
1129362067 15:75030217-75030239 CCATCCCCCAGACTCTTGTCAGG + Intronic
1129410501 15:75348080-75348102 CCCTCCCCCAGGCCCGGGGCAGG + Intronic
1129670769 15:77606560-77606582 GCTTCCCCCAGCCCCAGCTCTGG + Intergenic
1129843635 15:78758399-78758421 CCAGCCTCCCGCCCCTGGTCAGG + Intergenic
1130068332 15:80625290-80625312 CCTTCCTCTAGCCCCTGATGCGG - Intergenic
1130141166 15:81227594-81227616 CCTTGCCACAGCCCTTGTTCTGG - Intronic
1130258169 15:82335401-82335423 CCAGCCTCCCGCCCCTGGTCAGG - Intergenic
1130375770 15:83327360-83327382 CCCTCACCCTGCCCCTTGTCAGG - Intergenic
1130596760 15:85254559-85254581 CCAGCCTCCCGCCCCTGGTCAGG + Intergenic
1130908261 15:88254724-88254746 CCTTCCTCCAGACCTTGGCCAGG + Intronic
1131116502 15:89799381-89799403 CCTGCCCCCTGCCCCAGGACAGG - Intronic
1131456493 15:92586147-92586169 CCTTCCCCCAGCCTCTGCAGGGG - Intergenic
1132374221 15:101318153-101318175 CCGGCCCCCAGTCCCTGGTAGGG + Intronic
1132503638 16:296303-296325 CCCTCACCCAGGCCCTGGCCAGG - Intronic
1132527834 16:426226-426248 CCTCCCTCCAGCCCCGGGGCCGG - Exonic
1132544461 16:527036-527058 CCCTCCCCCAGGCCCTGGTTGGG + Intergenic
1132712230 16:1274145-1274167 CCTGCCCCCAGCCTCAGCTCAGG + Intergenic
1132752384 16:1464783-1464805 TTTTCCCCCAGCCGCTGGTGAGG - Intronic
1132789493 16:1677947-1677969 CATGCCCGCAGTCCCTGGTCGGG + Intronic
1132827281 16:1911665-1911687 GCGTGCCCCAGGCCCTGGTCCGG - Exonic
1132842295 16:1984078-1984100 TCTGCCCCCAGCCCCGGCTCGGG + Intronic
1133020899 16:2966596-2966618 CCCTACCCCAGCCCCTGCCCTGG + Intronic
1133281008 16:4665225-4665247 CCAAGCCCCAGCCCCTGCTCAGG - Intronic
1133356118 16:5138202-5138224 ACATGCCCCAGCCCCAGGTCAGG - Intergenic
1133732756 16:8590434-8590456 TCTTCCCGCAGCTCCTGCTCTGG + Intergenic
1134748985 16:16610851-16610873 CCATGCTCCAGCCCCTGGGCTGG - Intergenic
1134996478 16:18742778-18742800 CCATGCTCCAGCCCCTGGGCTGG + Intergenic
1135992068 16:27224337-27224359 CCTCCCCCCACCCACTGCTCAGG - Intergenic
1136609840 16:31359582-31359604 CCTCCCCTAAGCCCCTAGTCTGG - Intronic
1136626001 16:31462575-31462597 CCTCCCAGCAGCCCCTGGTGCGG + Exonic
1138657699 16:58500485-58500507 GCTCCCCCCAGCCCCTGCTATGG - Intronic
1139354734 16:66360865-66360887 CCTTGCCGCAGCCCCTGGGAGGG - Intergenic
1139691704 16:68645729-68645751 CCTTTCCCCAGCGCCTGGCCGGG - Exonic
1139909760 16:70390489-70390511 CCTTCCCTCAGGCCCTGGGCCGG + Intronic
1139950560 16:70666280-70666302 CCTTCCCCCACCCCCTTCTATGG - Intronic
1140228242 16:73096099-73096121 CCTCCTCCCAGCACCTGGTTGGG + Intergenic
1140296278 16:73712421-73712443 CCCTTCCCCAGCCCCTGCCCAGG + Intergenic
1141438406 16:84014018-84014040 CCTTCCCTCAGGCTCTGGGCGGG - Intronic
1141750035 16:85952273-85952295 CCTTTCCCCAGCACCAGGTCTGG - Intergenic
1141880169 16:86852914-86852936 CCTTTCTCCAGGCCCAGGTCAGG - Intergenic
1142132502 16:88437401-88437423 CCGTCCCCCGACCCCTGGGCCGG + Exonic
1142188480 16:88706139-88706161 CCTCCCCGCGGCCCCTGGGCGGG + Intronic
1142247759 16:88977563-88977585 CCTCTCCTCAGCCCCTGCTCCGG + Intergenic
1142941244 17:3381418-3381440 CCTTTCCTCAGGCCCAGGTCAGG - Intergenic
1143269652 17:5666180-5666202 CCATCCCCCAGTCCATGTTCTGG + Intergenic
1143500729 17:7337047-7337069 CCCTCCCCCAGCACCTGCTCTGG + Intronic
1144286848 17:13785366-13785388 CCACCCCCCAGCCCCAGGCCTGG - Intergenic
1145761396 17:27427170-27427192 CCTTCCCCCAACCCCATGACAGG + Intergenic
1146183143 17:30709708-30709730 CTTCCCCCCAGCCCCGGCTCCGG + Intergenic
1147216352 17:38901370-38901392 CCTTCCCCCAGCTCCTGCAGAGG - Intronic
1147585003 17:41648883-41648905 CCTTCCCCCAGGCCCTGGACGGG - Intergenic
1147611504 17:41804270-41804292 ACTTACTCCAGCCCCTAGTCTGG + Intronic
1148142545 17:45338725-45338747 CTTCCTCCCAGCCCCTGGTCTGG - Intergenic
1148196187 17:45715086-45715108 CCTGCCCCTTGCCCCTGCTCTGG - Intergenic
1148577689 17:48723118-48723140 CCTCCCCCCAGGCACTGGCCTGG - Intergenic
1148739249 17:49882916-49882938 CCTTCCCAAATCCCCTGGGCAGG + Intergenic
1148945504 17:51259537-51259559 CCTGCCCCCGCCCCCTGCTCTGG - Intronic
1149682148 17:58514259-58514281 CCTTCCCGAGGCCCCTGGCCCGG - Intronic
1150800949 17:68282345-68282367 CCTTCCCCCAACCCCACGACAGG - Intronic
1151457060 17:74232585-74232607 CCTTGCCCCAGGCCCTGGTGGGG + Intronic
1151675614 17:75595884-75595906 CCTGCCCTCAGTCCCTGGACGGG + Intergenic
1152020960 17:77780021-77780043 CTCTCCCCCAGCCCCGGGACAGG + Intergenic
1152069183 17:78126694-78126716 CCTTCCAGCAGCCCCTGCTCAGG + Intronic
1152078439 17:78172268-78172290 GCTTCCCCCCGGCCCGGGTCAGG + Exonic
1152246332 17:79186561-79186583 GCTTCCCCCACCCCCTGCTCAGG - Intronic
1152260123 17:79262300-79262322 CCTACCCACAGCCCCTGTCCGGG - Intronic
1152290781 17:79438802-79438824 CCTCCCCTCAGCTCCTGCTCGGG - Intronic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1152739257 17:82011901-82011923 CCTTCCCACAGCCCTCGGGCAGG - Intronic
1153077839 18:1185695-1185717 CCTTTCCCCAGCCCCTCAACCGG - Intergenic
1154497769 18:14975059-14975081 CCCACCCCCAGCCCCTGCTGTGG + Intergenic
1156472762 18:37387907-37387929 GCTTCCCCCAGCCCCAGGCCAGG - Intronic
1156495065 18:37520189-37520211 CCTTCCCCTGGCCCCAGCTCTGG + Intronic
1157544634 18:48539261-48539283 CCTTCCCCCACCCCCGACTCGGG + Exonic
1157578680 18:48760674-48760696 TCTTCTTCAAGCCCCTGGTCTGG + Intronic
1157845322 18:50998962-50998984 CCTTACCCCAGCCTCTGGGCTGG - Intronic
1160094526 18:75859704-75859726 TCTGCCACTAGCCCCTGGTCTGG + Intergenic
1160223245 18:76992453-76992475 CCAGCCCCCAGGCCCTGGACCGG - Intronic
1160834044 19:1116366-1116388 CCTGCCCCCTGCCCCTGTCCTGG - Intronic
1160867578 19:1262573-1262595 CCCTCCCCCACCCGCTGGGCTGG - Intronic
1160879322 19:1312436-1312458 CCTTCCCAGGGCCCCTGGCCTGG + Intergenic
1160957790 19:1701643-1701665 CCTTTCCCCAGCCCCCCGGCCGG + Intergenic
1161081018 19:2310192-2310214 CCTCCCTCCAGCCCTTGGCCTGG - Intronic
1161278721 19:3433745-3433767 CCTTCCCAGAGCCCAAGGTCAGG + Intronic
1161290294 19:3490513-3490535 TCTTCCCCCAGCTCCTGTTGTGG - Intergenic
1161298665 19:3532406-3532428 CTGTCCCCCAGCTGCTGGTCTGG + Exonic
1161327787 19:3671739-3671761 CCTGCCCCCACCCCCTGGGCAGG - Intronic
1161337375 19:3721809-3721831 CCCTCCCCCAGCCCGGGGTGGGG + Exonic
1161441221 19:4292690-4292712 CCCTGCCCCAGCCCCAGGCCCGG - Exonic
1161682488 19:5687120-5687142 CCTAGCCCAAGCCCCTGCTCCGG + Intronic
1161719491 19:5895135-5895157 CCTTGCCCCAGCCCCAGCTGGGG - Intronic
1161750494 19:6092712-6092734 CCCTCCCCCGGCCCCTCCTCTGG - Intronic
1161836968 19:6654411-6654433 CCTACCCCCACCCCCTGGGCAGG - Intergenic
1161977005 19:7612567-7612589 TATTCCCCCAGCCCCTCGTGGGG - Exonic
1162031646 19:7920177-7920199 CCTTCGCCCCGCCCCAGTTCCGG + Intergenic
1162760660 19:12886385-12886407 CCTTCCCCCATCCCCGAGTGTGG - Intronic
1162936328 19:13983452-13983474 CCCTCCCCCACCCCCTGGGAGGG + Intronic
1162975651 19:14206066-14206088 CTTCCCCCCAGCCCCGGCTCCGG - Exonic
1163188158 19:15654076-15654098 CCTTCCTCCAGCCCCTGGCCTGG - Intronic
1163216732 19:15884772-15884794 CCTTCCTCCAGCCCCTGGCCTGG + Intronic
1164203047 19:23034173-23034195 CCTTCCTCAAGCCCCATGTCTGG + Intergenic
1164838380 19:31373814-31373836 CCTTCCCCCAGAACCTGGTAGGG - Intergenic
1165108879 19:33489737-33489759 CCTTGCCCCTGCCCCTGCCCTGG + Intronic
1165110608 19:33499968-33499990 GCTTCCCCCTTCCCCTGGGCAGG - Intronic
1166121035 19:40686947-40686969 CCTGCCCCCAGCCCCCTGTGGGG - Exonic
1166523168 19:43495002-43495024 CCAGCCCCCAGCCCCTCCTCAGG - Intronic
1166852103 19:45765971-45765993 CCTGCCGCCAGCCCCCGGCCTGG - Exonic
1167071704 19:47226066-47226088 CCGCCCCCCAGCCCCTGGCACGG - Intronic
1167379291 19:49129363-49129385 CCTGCCCCGATCCCCAGGTCCGG + Exonic
1167384998 19:49157898-49157920 CGCTCCCGCAGACCCTGGTCCGG - Intronic
1167519562 19:49945847-49945869 CCCTCCCCCGGCCCCTTGACAGG + Intronic
1167559595 19:50217822-50217844 GCTTCCGGCAGCCCCAGGTCAGG - Intronic
1167650805 19:50727648-50727670 CCTTCCCCCAGCCCCTTGCGGGG + Intergenic
1168723766 19:58569734-58569756 GCTTCACCCAGCCCCTGAGCTGG - Intronic
924982964 2:239984-240006 CCTTCCCCCAGCCCCTGGTCAGG + Intronic
924991226 2:314805-314827 CCTTCTGCCTGCCCCTCGTCTGG - Intergenic
925621305 2:5795875-5795897 CCTCTCCCCAGCCCCTTGACAGG + Intergenic
926198009 2:10775221-10775243 CCTCCCCCCAGACCCTGCTCAGG - Intronic
927088860 2:19695158-19695180 CCAGCCCCCAGCTCCAGGTCTGG - Intergenic
927594658 2:24386005-24386027 AGTTCCCCCAGGCCCTGGACAGG + Intergenic
927926394 2:27016758-27016780 TCTGCCCCCAGCAGCTGGTCTGG + Intronic
928106123 2:28471696-28471718 CCTTCCCACAGCCCCCGCCCTGG + Intronic
928423801 2:31161298-31161320 CCTTCCTCCAGCCTCTGCTCTGG + Intergenic
929276235 2:40027786-40027808 CCTTCCCCCCACCCCAGGTCAGG - Intergenic
929278372 2:40050140-40050162 CCTTCCTTCAACTCCTGGTCAGG + Intergenic
930529666 2:52572974-52572996 GCCACCCCCAGCCCGTGGTCAGG + Intergenic
932490399 2:72116310-72116332 GCTTCCTGCAGCCCCTGTTCTGG - Intergenic
933507636 2:83199152-83199174 CGTTCCCCCACCCCCTGGCAGGG + Intergenic
933595312 2:84277612-84277634 CCTTCCTCCTGCCCCAGCTCTGG - Intergenic
933722500 2:85407248-85407270 CAGTGCCCAAGCCCCTGGTCTGG + Intronic
933776489 2:85774203-85774225 ACTGTCCCCAGCCCCTGGTATGG + Intronic
934523113 2:95032329-95032351 CCTACTCCCAGCCCCTTCTCTGG - Intronic
935130730 2:100259046-100259068 CATTCCTCCATCCCCTGCTCTGG - Intergenic
935344527 2:102093762-102093784 CCACTCCCCAGCACCTGGTCTGG + Intronic
935816697 2:106852651-106852673 CCAACCAACAGCCCCTGGTCAGG - Intronic
936703817 2:115045641-115045663 CCCTCCGCCGTCCCCTGGTCTGG - Intronic
937099745 2:119259658-119259680 ACTGTCCCCAGCCCCTGATCTGG - Intronic
937252645 2:120534218-120534240 GCTTCCCCCACCTCCTGGCCTGG - Intergenic
937892504 2:126949289-126949311 CACTCTCCCAGCCCCTGCTCAGG + Intergenic
937911976 2:127080208-127080230 CCTTGTCCCAGCTCCTGTTCTGG - Intronic
938494088 2:131783093-131783115 CCTTCGCTCAGTCCCAGGTCTGG + Intergenic
940961886 2:159795651-159795673 CCTTCCCCCAGTCCTTGGCATGG - Intronic
941110828 2:161417354-161417376 CCATCGCCCAGCCGCTGGCCAGG - Intronic
941300166 2:163790781-163790803 CCTTCCCCCAACCCCACGACTGG - Intergenic
941951284 2:171160169-171160191 CCATCCCCCACCCCAGGGTCTGG + Intronic
941978377 2:171430386-171430408 CCCTCCCCTAGCCCCTAGACAGG - Intronic
942613590 2:177766374-177766396 CCTTAACCCAGCCCATGGACTGG - Intronic
942729695 2:179050833-179050855 CCTACCCCCACCTCCTGTTCAGG + Intergenic
944649643 2:201816765-201816787 CCTCCCCCCAGGCCCTGTTTTGG - Intronic
944996352 2:205298881-205298903 CCTCGGCCCAGCTCCTGGTCTGG + Intronic
946258691 2:218467183-218467205 CCTTCCCCCTCCCCCTGCCCAGG + Intronic
946396867 2:219447789-219447811 CCTCTCCCCAGCACCTGCTCTGG + Intronic
948149131 2:235730968-235730990 CCAACCCCCAGCCCCTAGCCCGG + Intronic
948515841 2:238503480-238503502 CCCTCACTCAGCCCCTGGGCGGG - Intergenic
948529786 2:238597079-238597101 GCTTCCCCAAGCCTCTGTTCAGG - Intergenic
948603856 2:239122586-239122608 CCTCTCCCCAGCCTGTGGTCGGG - Intronic
948616714 2:239203965-239203987 CCTTCCCACAGCTCCTGGTTAGG + Intronic
948809711 2:240468346-240468368 CCTGCCTCCTGCCCCTGCTCTGG + Intergenic
949077796 2:242072185-242072207 CATTCCGCCAGCTCCTGGGCGGG - Intergenic
1170864948 20:20145992-20146014 CCTTGCCCCACCTCCTGGCCTGG + Intronic
1172618384 20:36305177-36305199 CCTTTCCCCAGTGTCTGGTCTGG - Intergenic
1172759176 20:37309997-37310019 GCTTCCACCAGCCTGTGGTCTGG + Intronic
1172868677 20:38120751-38120773 CCTGCCCCCATCACCAGGTCAGG + Intronic
1173497218 20:43528484-43528506 CCTCCCCTCAGCCCCGTGTCTGG + Intronic
1173800343 20:45891095-45891117 CCTTCCCCGAGCCTCTGCCCGGG + Exonic
1173934111 20:46846239-46846261 CCCTCCACCAGCCTCTGGCCTGG - Intergenic
1174648468 20:52105089-52105111 CCGGCCCCCAGCCCCCGGGCGGG + Intronic
1175113433 20:56664938-56664960 GCTTCCCCCATCCCCTGTCCTGG - Intergenic
1175174961 20:57105883-57105905 CCTTCTCCCACCCCGTGGTCAGG - Intergenic
1175745500 20:61454183-61454205 CCTTCTCCCAGGCCCTGGGCCGG + Intronic
1175960925 20:62636022-62636044 CCATGCCCCAGCCCCTCCTCAGG - Intergenic
1175966063 20:62660822-62660844 CCTTCCCCCAGCCCCACTTTGGG + Intronic
1176013281 20:62912184-62912206 CCTGGCCCCAGCCCCTGGTTGGG - Intronic
1176048839 20:63105986-63106008 ACCTCCCACAGCCCCTGTTCTGG - Intergenic
1176206649 20:63892321-63892343 CCTCCACTCTGCCCCTGGTCTGG + Intergenic
1176613827 21:9011274-9011296 CCTTCTCTCAGTCCCAGGTCTGG - Intergenic
1176711367 21:10152615-10152637 CCTTCTCTCAGTCCCAGGTCTGG + Intergenic
1176937456 21:14883446-14883468 CCCTCACCAAGTCCCTGGTCTGG + Intergenic
1178509724 21:33194221-33194243 CATTCCCCAAGCTCATGGTCTGG + Intergenic
1178921730 21:36743306-36743328 CCTGGCCCCAGCCCTTGGGCAGG - Intronic
1179176137 21:39009682-39009704 CCTTTCCCCAGGCCCTGCTGAGG - Intergenic
1179792782 21:43764965-43764987 CCTTCCCCCAGCTCTTTGGCAGG - Intergenic
1179991365 21:44949763-44949785 CCTGCACCCAGCCCTTGGGCAGG + Intronic
1180687222 22:17678952-17678974 CCTTCCCCCACACCCAGGTAGGG + Intronic
1181041489 22:20194703-20194725 CCCCACCCCAGCCCCTGGTCAGG + Intergenic
1181638998 22:24187130-24187152 CCCTCCCGCAGCCCCAGGACAGG - Intronic
1181717005 22:24738303-24738325 AGTTCCCCCAGGCCCTGGGCAGG - Intronic
1181996834 22:26889547-26889569 CCTTACCCCAGCATCTGCTCTGG - Intergenic
1182058868 22:27382437-27382459 CCTTCCCCCAACCCCAGGCTGGG + Intergenic
1182713985 22:32340625-32340647 CCCTTCCACAGCCCCTGCTCAGG - Intergenic
1183505155 22:38204596-38204618 GATTCCCCCAGCCCCTGCCCTGG - Intronic
1183737302 22:39651049-39651071 CCATCCACCAGCCCCTGGATGGG + Intronic
1183960640 22:41409968-41409990 CCTTCACCCACACCCTGGGCAGG - Intergenic
1184171974 22:42765253-42765275 CCATGCCCCAGCCCCCGGCCTGG + Intergenic
1184646251 22:45896996-45897018 CCTCACCCCAGCCCCTGATGGGG + Intergenic
1184670665 22:46010986-46011008 CCTTCCCCCAGCCACTCTCCTGG - Intergenic
1184785238 22:46668437-46668459 CCTCCCCACCGCCCCTGGCCAGG + Intronic
1184992822 22:48182197-48182219 CATTCCCCAAGTCCCAGGTCAGG + Intergenic
1185415089 22:50705365-50705387 CGTTCCCCCAGCCCCTGGCGTGG + Intergenic
949864896 3:8539495-8539517 TCTCCCTCCAGCCCCAGGTCTGG + Intronic
950521112 3:13498608-13498630 CCCTCCCCCAGCCCCCTTTCAGG - Intronic
950541983 3:13618302-13618324 CCTTCCCATAGCCCCTGCCCTGG - Intronic
950565941 3:13769641-13769663 CCTTTCCACAGGCCCTGCTCTGG + Intergenic
950652131 3:14413703-14413725 CCTTCCCCCAGCCCCACCCCCGG - Intronic
953136185 3:40183622-40183644 ACTTCCCCCAACCCCTGCACAGG + Intronic
953503274 3:43458806-43458828 CTTTCCCCCTACCCCTGGACAGG + Intronic
953577044 3:44121154-44121176 CCTTCCCTGAGCCCCGGGCCAGG + Intergenic
953911595 3:46895997-46896019 TCTTCTCCCAGCCCCTTGCCTGG - Intronic
954301340 3:49702238-49702260 CCTTCCCCCAGCCCCTGCCATGG - Intronic
954370408 3:50167078-50167100 TCTTCTCCCACCCCCTGCTCAGG + Intronic
954371528 3:50171657-50171679 CATTCCCCCACCCCCAGGGCTGG - Intronic
954433905 3:50485894-50485916 CTGTCCCCGTGCCCCTGGTCTGG - Intronic
954443516 3:50534487-50534509 CCCTCCCCCAGCTCCATGTCTGG + Intergenic
954447666 3:50555374-50555396 CCTTTTCCCAGCCCCTGGCCTGG - Intergenic
954476507 3:50751419-50751441 CCTTCCCCCAATGCCTGGACAGG + Intronic
954886866 3:53882260-53882282 CCCGCCCCCAGCCCCTGCGCCGG - Intergenic
956534167 3:70256967-70256989 CCTTCGCTCAGCCCATAGTCGGG - Intergenic
959008599 3:101048567-101048589 CCTCCCCCTAGCCCCTGGTAAGG - Intergenic
959595608 3:108125629-108125651 CCTTCCCGCACCCCCTGGCTAGG + Intergenic
961444332 3:126972123-126972145 CCTTCCTCCAGCCCCCGCACAGG - Intergenic
961573363 3:127816310-127816332 CTTTCCCCCACCCCCTGCTTTGG - Intronic
961605435 3:128091281-128091303 CGTTCCCCCAGCTCCTGCTGAGG - Intronic
961654975 3:128436156-128436178 CCTTGCCCTTGCCTCTGGTCTGG + Intergenic
961751883 3:129101368-129101390 CCTTGTCCCAGCCTCTGCTCTGG + Intronic
961823147 3:129585512-129585534 CCTCCCTCCATCCCCTGTTCTGG + Intronic
963268034 3:143258472-143258494 TCTTTCCCCAGCCACTGGCCTGG - Intergenic
963811856 3:149785408-149785430 CCTTCCCCCAACCCCACGACAGG + Intronic
966943179 3:184759784-184759806 CCTTGCCCCAGCCCCTCTCCAGG - Intergenic
967754185 3:193149839-193149861 CCCTCCCCCAACCCCAGGACAGG - Intergenic
968674847 4:1871703-1871725 CGGTCCCCCAGCCCCTGAGCCGG - Intronic
968914010 4:3489315-3489337 CCCTCCCCCATCCCCAGGGCCGG - Intronic
968971932 4:3800376-3800398 CCTGCCCCCTGCACCTGGACTGG - Intergenic
969432176 4:7161745-7161767 CCGTCCCCCAGCCCATGGGGAGG - Intergenic
969439183 4:7207393-7207415 CGTTCACCCAGCGCCTGGCCAGG + Intronic
969657659 4:8507454-8507476 TCCTCCCCCAGCGCCTGCTCTGG + Intergenic
969708991 4:8831949-8831971 CCGGCCCCCAGCCCCCGCTCCGG - Intergenic
970791483 4:19862950-19862972 CCCTCCCCCTGCCCCAGGACAGG + Intergenic
971795146 4:31217492-31217514 CCCTCCCCCAACCCCAGGACAGG + Intergenic
973265239 4:48203963-48203985 CCTTCCCCCAGTGCCTGCACAGG - Intronic
973961762 4:56117509-56117531 CCTCCCCCCACCCCCTCCTCTGG - Intergenic
974877763 4:67718302-67718324 CCTGCTCCCAGCCCCTGGCCAGG - Intergenic
975648475 4:76568616-76568638 CCTGTCCCCAGCCCTTGTTCGGG + Intronic
975848876 4:78551719-78551741 CCTTCCTCCTGCCCCTCCTCCGG - Exonic
976041028 4:80885463-80885485 CCTTCCTCCTGCCCAAGGTCAGG + Intronic
976444184 4:85111022-85111044 AGTTCCCCCAGGCCCTGGGCAGG - Intergenic
977568789 4:98609350-98609372 CTCTCCCCCAGCCAGTGGTCGGG - Intronic
977693776 4:99946254-99946276 CCTGGCCCCAGCCCCGGCTCCGG - Intronic
979596344 4:122538701-122538723 CCTTTCCCTATCTCCTGGTCTGG + Intergenic
979618881 4:122775975-122775997 ACTTGGCCCACCCCCTGGTCAGG - Intergenic
980379342 4:131991269-131991291 TCTTCCCCCAACTCCTGGCCTGG - Intergenic
981225495 4:142289534-142289556 CCAGCCCCCAGCCCTTGGACAGG + Intronic
981229535 4:142336554-142336576 TCTTCCCCCAACCCCTGGTGTGG - Intronic
982080701 4:151786828-151786850 CTTTCTCCCAACCCCTGGTGTGG - Intergenic
982402020 4:154978700-154978722 CCCTCCCCCAGCCCCATGACAGG + Intergenic
983524130 4:168743170-168743192 CCTTGCCCCAGCCCCTGCCCTGG + Intronic
983570801 4:169206376-169206398 CCTTCCCCCAGCCCCTTGAATGG - Intronic
983889308 4:173014493-173014515 CCTTCCCCTAGGCCCTGGAGAGG - Intronic
985635287 5:1032914-1032936 CCTCCCCGCAGCCTCTGGGCAGG - Intronic
985718734 5:1477367-1477389 CCTTCCCCCATCGCCGAGTCAGG - Intronic
985861109 5:2471366-2471388 CTGTCCCCCAGCACCTTGTCAGG + Intergenic
986672973 5:10159342-10159364 CCTTCCCCCAACCCCTCAACAGG - Intergenic
989232540 5:39102452-39102474 CCTTCCCCCACCACATGGTCAGG + Intergenic
990582255 5:57175725-57175747 CCTTCCCCCACCCCGTTGTTGGG + Intronic
992716169 5:79513745-79513767 CCTGCCCCCAGCTCCAGGGCGGG + Exonic
993372149 5:87105974-87105996 CCCTCCCCCAGCCCCATGACAGG - Intergenic
995460299 5:112396092-112396114 CCTTCCCCCAACCCCACGACAGG - Intronic
995476327 5:112552158-112552180 TCTTCCCCCAGCCCTTGGTCTGG - Intergenic
996504850 5:124257510-124257532 CCTTCCCCCAAGTCCTGGCCAGG + Intergenic
997185898 5:131881557-131881579 CATAGCCCCAGCCTCTGGTCTGG + Intronic
997186322 5:131885082-131885104 AGTTCCCCCAGACCCTGGGCAGG - Intronic
997454375 5:134006120-134006142 CCCTCCCCCAGCCCCTACACAGG - Intergenic
997530782 5:134579984-134580006 CCTTCCCAGAGCCGCTGGGCTGG - Exonic
998146818 5:139733861-139733883 CCTACCCCCAGCTCCTGGGCTGG - Intergenic
998230315 5:140357511-140357533 CCTACCCCCAGCCTCGCGTCTGG - Intergenic
1000522867 5:162319190-162319212 CCATCCTCCAGACCCTGGACTGG + Intergenic
1000854404 5:166380512-166380534 CCTTCCCCCAACCCCACGACAGG + Intergenic
1001517388 5:172365494-172365516 CCTTCCCCGAGGGCCTGGTCAGG + Intronic
1001705281 5:173737079-173737101 TCTTCCCCCAGCCCCAGGGGTGG - Intergenic
1001761124 5:174209209-174209231 ACTTCCCTCAGCCTCTGGCCTGG - Intronic
1001831597 5:174793801-174793823 CCTTCCCGCAGGCCCGGGGCTGG + Intergenic
1001894399 5:175365916-175365938 CCATCCCCCAGGCCATGGACCGG + Intergenic
1002174864 5:177396188-177396210 CCTTCCCTGACCCCCTGCTCTGG - Intronic
1002183184 5:177441930-177441952 CCGTCCCTCAGCCCCTGGCCTGG + Exonic
1002302200 5:178263415-178263437 CCCTTCCCCAGCCCTTGGGCAGG + Intronic
1002430196 5:179198978-179199000 CCTTTCCCCAGCCTCTGCTTGGG - Intronic
1002696946 5:181098266-181098288 CCTTCCCCCAGCCGCGGGCGAGG - Intergenic
1002697676 5:181101107-181101129 CCTTCCCCCAGCCGCGGGCGAGG + Intergenic
1002921304 6:1575272-1575294 CCTTCCCCCAGTGCCTGCCCTGG + Intergenic
1002924506 6:1597240-1597262 CCTCCCCCCAGCTCCAGTTCTGG + Intergenic
1003325598 6:5087606-5087628 CCATCCCCCATCCCCTGCGCTGG - Exonic
1003642528 6:7887804-7887826 TGTTCCCCCAGCCCCAGCTCTGG + Intronic
1004034210 6:11906838-11906860 CCTTCCCCCAACCCCACGACAGG + Intergenic
1005392214 6:25345139-25345161 CCTTGCCGAAGCCCATGGTCAGG + Intronic
1005495377 6:26383475-26383497 CCCTCCCCGAGACCCAGGTCGGG - Intronic
1006173043 6:32106390-32106412 CCTTTCCCCAGCCTCTGGTCTGG - Intronic
1006271602 6:32970304-32970326 CCTTCCCCCAGCCAGGGATCAGG - Intronic
1006337038 6:33426234-33426256 GCCCCTCCCAGCCCCTGGTCTGG + Intronic
1006717197 6:36128128-36128150 CCCTCCCCCACCCCCTACTCTGG - Intronic
1006899962 6:37493648-37493670 CTTTCTCCCAGCCCCTGGCTTGG + Intronic
1006950519 6:37818779-37818801 CCCTCCCCCAGCCCCTTGTCTGG - Intergenic
1007225211 6:40308838-40308860 CCAACGCCCAGCCCCTGGACGGG + Intergenic
1007788685 6:44296978-44297000 ACTTACCACAGCCCCTGGGCTGG + Intronic
1008584157 6:52933873-52933895 CCTCCCCACAGCCCCTGGTGGGG - Intergenic
1009047769 6:58249662-58249684 CCTTCCCCCACCCCTTGATATGG + Intergenic
1009223570 6:61003955-61003977 CCTTCCCCCACCCCGTGATATGG + Intergenic
1010264677 6:73852862-73852884 AGTTACCCCAGCCCCTGGACAGG + Intergenic
1011312761 6:85998799-85998821 CCCTCCCCCAACCCCATGTCAGG + Intergenic
1017372931 6:153735109-153735131 CCATCCCCCAGCTCCTGGACTGG + Intergenic
1018000298 6:159572770-159572792 CCTTCTCCAGGGCCCTGGTCAGG - Intergenic
1018057709 6:160066884-160066906 CCTGCCACCTGCCCCTGGTTTGG + Intronic
1018939324 6:168297911-168297933 CCGTGTCCCAGCCCCTGGTGAGG + Intronic
1019751980 7:2736503-2736525 ACTGCCACCAGCCCCTGCTCAGG - Intronic
1019772380 7:2891712-2891734 CCTCCCCCCCTCCCCTGGTATGG - Intergenic
1019795391 7:3044366-3044388 TCCTCCCTCAGCCCCTGTTCTGG + Intergenic
1019917810 7:4144681-4144703 CCTGCCCTCAGCCTCTGTTCCGG - Intronic
1020028602 7:4917296-4917318 CCTCCCCACAGCCCCGTGTCAGG - Intronic
1021332807 7:19359392-19359414 CCTTCCCCCAACCCCATGGCAGG - Intergenic
1021615553 7:22499875-22499897 GCTCCCCCCAGCCCCCGGCCCGG + Intronic
1021677584 7:23097094-23097116 CCTGCTCCCAGCACCTGCTCTGG + Intergenic
1022094671 7:27131036-27131058 CCCTCCCCCAGCCCAGGGGCCGG - Intronic
1022336062 7:29423294-29423316 CATTCCCCCAGCAGCTGGGCAGG + Intronic
1022896907 7:34759567-34759589 CCTTTTCCCAGCCCCAGGCCAGG + Intronic
1023725480 7:43138794-43138816 CCTTCCCCCTGCCCCTACCCTGG - Intronic
1023874191 7:44277954-44277976 CCTGGGCCCAGCCCCTGGTTAGG + Intronic
1026571683 7:71536915-71536937 CCCTTCCCCAGCCCCTGCACAGG + Intronic
1026805021 7:73424073-73424095 CCCTGCCCCAGCCCCGGGCCGGG - Intergenic
1028218170 7:88160957-88160979 CCTTCCCCCTGCCCCATGACAGG - Intronic
1029518990 7:101048133-101048155 CCTTCCCCCACCCCATGCCCTGG + Intronic
1030324267 7:108203367-108203389 CCTTCCCCCATCCCCAGGACTGG - Intronic
1030970672 7:116051140-116051162 CCTTCCCCCAACCCCAAGACAGG - Intronic
1032213799 7:129940757-129940779 CCTTCCCCAAGCATCTGGTGAGG + Intronic
1032263793 7:130356484-130356506 CCTTCCCCCAGCCCCAGGAATGG + Intronic
1032740142 7:134730364-134730386 TCCTCCACCAGTCCCTGGTCTGG - Intergenic
1032784401 7:135188884-135188906 CCTTGCCCCAGCCCAGGCTCTGG + Intronic
1033543045 7:142374864-142374886 CCTTCCCCCAACCCCCCGACAGG - Intergenic
1033755745 7:144397399-144397421 CCTGCCCCCAGGCTCTGGGCAGG - Exonic
1033815560 7:145068675-145068697 CCTTCCCCCAACCCCAAGGCAGG + Intergenic
1034100525 7:148446177-148446199 CCTCCACCCAGCTCATGGTCAGG - Intergenic
1034237664 7:149585284-149585306 CTTTTCCCCAGTCCTTGGTCTGG - Intergenic
1034240745 7:149608943-149608965 CTTTTCCCCAGTCCTTGGTCTGG - Intergenic
1034474816 7:151276132-151276154 CCTCCCCCCCGACCCTGGACTGG - Intronic
1034498620 7:151436217-151436239 TCTTGACCCAGCCCCTGCTCTGG + Exonic
1034729596 7:153374837-153374859 CCTTCCCCTATCCCAGGGTCTGG + Intergenic
1035560704 8:601727-601749 CCTGCCCCCTGCTCCTGGCCAGG - Intergenic
1037295712 8:17397624-17397646 AGTTCCCCCAGGCCCTGGGCAGG - Intronic
1037526222 8:19727085-19727107 CCTTCCCTCAGCCCCAGGAATGG - Intronic
1037643796 8:20772070-20772092 CGTTCCACCAGGCCCTGGTGTGG - Intergenic
1037988503 8:23304383-23304405 CCTTCCTTCAGCCCCGGGCCTGG - Intronic
1038008707 8:23457304-23457326 CGCTCCCCCAGCCCCTGGCAGGG - Intronic
1040081854 8:43292788-43292810 CCTCCTCCCAGCCCCAGGCCCGG - Intergenic
1040531463 8:48269787-48269809 CCTTCCCCCAGCGCCTGCCCTGG - Intergenic
1041102652 8:54412232-54412254 CCTTCTCCCCACCCCTCGTCAGG + Intergenic
1041829080 8:62132477-62132499 CCTTCACAAAGCACCTGGTCAGG - Intergenic
1042172902 8:66009491-66009513 CCTTACCCCAGCCACTTGGCTGG + Intergenic
1044554012 8:93542447-93542469 CCTCCCCCCGGCCCCCGCTCTGG - Intergenic
1045160755 8:99541496-99541518 CCTTCCCCCTGCACCCGGACAGG + Intronic
1045940426 8:107732205-107732227 CCCTCCCCGAGCCCCTCGACAGG - Intergenic
1046293098 8:112187867-112187889 CCTTCCCCCCGCCCCATGACAGG - Intergenic
1047432777 8:124807072-124807094 GCTTCCCTCTGCCCCTGGACAGG + Intergenic
1048296624 8:133219369-133219391 TCCTCCCCCAACCCCTGGGCGGG + Intronic
1048450991 8:134533881-134533903 CCATGCCACAGCCCCTGGTCAGG + Intronic
1048472907 8:134719338-134719360 CCTTCCACCAACCCCTGATGTGG - Intergenic
1048531005 8:135250530-135250552 CCACCCCCTAGCCCCTGGACAGG - Intergenic
1049012959 8:139899831-139899853 CCTGCCCTCAGCCCTTGGTGAGG - Intronic
1049181627 8:141225953-141225975 CCAGCCCCCAGCCCTAGGTCAGG + Intronic
1049204944 8:141359292-141359314 CCTTCAAACAGCCCCTGGCCTGG + Intronic
1049420071 8:142512534-142512556 CCTTCTCCCAGCCCGGTGTCAGG + Intronic
1049474031 8:142788606-142788628 CCCTCCTCCAGCCCCAGGTGTGG - Intergenic
1049538498 8:143194336-143194358 CTCTCCCCCAGCCCCTGCACTGG - Intergenic
1049538511 8:143194383-143194405 CTCTCCCCCAGCCCCTGCACTGG - Intergenic
1049538525 8:143194430-143194452 CTCTCCCCCAGCCCCTGCACTGG - Intergenic
1049538581 8:143194631-143194653 CTCTCCCCCAGCCCCTGCACTGG - Intergenic
1049606070 8:143529745-143529767 GCTTCCCCCAGCCCCAGAGCAGG - Intronic
1049767417 8:144361359-144361381 CCTCTCCCCAGGCCCTGGGCAGG + Intergenic
1051297403 9:15611120-15611142 CCTTCCTCCTGCTCCTGATCTGG + Intronic
1052996228 9:34552861-34552883 CTTACCCCCACCCCATGGTCTGG - Intronic
1053022104 9:34701799-34701821 CCTTCCCCCGGCCACCGGGCTGG - Intergenic
1053073528 9:35114980-35115002 CCTTGCCCCAGGGCCTGGCCTGG - Intronic
1053648355 9:40138306-40138328 CCTTCTCTCAGTCCCAGGTCTGG + Intergenic
1054329332 9:63736249-63736271 CCTTCTCTCAGTCCCAGGTCTGG + Intergenic
1054536225 9:66237864-66237886 CCTTCTCTCAGTCCCAGGTCTGG - Intergenic
1055482747 9:76725976-76725998 CCTTCTCCCAGCGCGTGCTCAGG - Intronic
1056138245 9:83649599-83649621 CCTTTCCCCAGCCCTTGGGCAGG + Intergenic
1056832715 9:89929797-89929819 CCCTTCCCCAGCCCCCGCTCAGG - Intergenic
1057471164 9:95357926-95357948 CCTTCCTCCAGCCCCGAGTAGGG - Intergenic
1057934158 9:99222454-99222476 GCTTCCCCCAGCCTCGGGTGTGG + Intronic
1059438413 9:114289684-114289706 CCTTCCCCCAGCCCCCAGACTGG + Intronic
1060200647 9:121650280-121650302 CCTGCCCCTCCCCCCTGGTCAGG + Intronic
1060332450 9:122685778-122685800 CCTTCCCTCAGCCTCTTCTCTGG + Intergenic
1060793319 9:126499856-126499878 CCCTCCCCCAGCCCGCGGGCCGG + Intronic
1060965899 9:127712148-127712170 CCTTCCCCCTTCCCCAGGACTGG - Intronic
1061004073 9:127918456-127918478 CCTCCTCCCAGCCCCTGGATAGG - Intergenic
1061132679 9:128716902-128716924 TCTTCCCCGAGCCCCAGGCCCGG + Exonic
1061193625 9:129095869-129095891 CCTGCCCCCAGCTCCTCCTCTGG + Intronic
1061225856 9:129280697-129280719 CCTGCCCACAGCCCCTGGCCAGG + Intergenic
1061481970 9:130901872-130901894 CCTGCCCCCGGCCCCTCGCCAGG + Intergenic
1061559440 9:131393722-131393744 CCTTCCCCCGGGCCCAGGCCGGG + Intergenic
1061946188 9:133909277-133909299 CCTCCCCCAAGTCCCTGGCCTGG + Intronic
1062000950 9:134215400-134215422 CCTTCCCCCAGCCCCTCCAGGGG - Intergenic
1062174175 9:135151752-135151774 CCGTCCCCCAGGCCTTGGCCTGG + Intergenic
1062307292 9:135915253-135915275 CCTCCACACAGCCCTTGGTCAGG + Intergenic
1062317663 9:135976423-135976445 CCTTCCCCCTCCCCAGGGTCAGG - Intergenic
1062357029 9:136169949-136169971 GCTTCCCCCAGCCCCTGCCACGG + Intergenic
1062387943 9:136321830-136321852 CTTTCTCCCATCCCCTTGTCGGG - Intergenic
1062460421 9:136660455-136660477 CCTGCCCCCAGCCCCTCCCCAGG - Intronic
1062526925 9:136981651-136981673 CCTTCCCCGAGCCCCTGCCCCGG + Exonic
1202796120 9_KI270719v1_random:121604-121626 CCTTCTCTCAGTCCCAGGTCTGG + Intergenic
1203745784 Un_GL000218v1:40138-40160 CCTCCCCAGAGCCACTGGTCAGG - Intergenic
1185489649 X:511488-511510 CCTTCCCCCAACCCCCTGACAGG - Intergenic
1185604362 X:1359338-1359360 CCCTCCCCCAGCCCCTGCCTGGG + Intronic
1185695998 X:2195148-2195170 CCTTCCCCCATCTCCTGGGTTGG - Intergenic
1186343121 X:8664039-8664061 CCTTCCCCCACCCCTTTGACAGG - Intronic
1187882160 X:23857422-23857444 CCCTGCTCCAGCCCCAGGTCAGG - Intronic
1188281791 X:28279322-28279344 CTTTCCCCCAACCCCTCGACAGG + Intergenic
1189495690 X:41506279-41506301 CCTTCCCCCAACCCCTGTGCTGG + Intergenic
1190712707 X:53081654-53081676 CCTTCCCCCATCCCCCGCTTCGG - Intergenic
1190823683 X:53997528-53997550 CCTTTCCAGAGACCCTGGTCTGG - Intronic
1190952902 X:55163186-55163208 CCTCCCTTCAGCCCCTGGCCAGG - Intronic
1190969721 X:55336794-55336816 CCATCCCCTAGCTCCAGGTCTGG + Intergenic
1191797232 X:65034539-65034561 CCGTCTCCCAGCCCCTCGACAGG - Intronic
1192185262 X:68942393-68942415 CCTTCCCACTGCCACTGTTCAGG + Intergenic
1192198357 X:69047386-69047408 CCATCCACCTGACCCTGGTCTGG + Intergenic
1192223180 X:69211178-69211200 TCTTCCCACAGCCCCTGGCATGG - Intergenic
1195095059 X:101493895-101493917 CTCTTCCCCAGCCCCTGATCTGG - Exonic
1195719342 X:107851521-107851543 CCTTCCCCCATCCCCTGCCCTGG + Intronic
1197712045 X:129678451-129678473 CCCTCTCCCGGCCCCTGGCCAGG - Intergenic
1198192784 X:134326722-134326744 CCTTCCCCCTACCCCTTGACAGG - Intergenic
1198276780 X:135102056-135102078 CCCTCCCCCATCCCCTTGTAAGG + Intergenic
1198664460 X:139004972-139004994 ACCTCCCCTAGGCCCTGGTCAGG - Intronic
1198778086 X:140202302-140202324 CCTTCCCCCTGAGCCTGCTCAGG + Intergenic
1199200021 X:145076166-145076188 CCATCCCCCAACCCCCAGTCCGG - Intergenic
1199428637 X:147733321-147733343 CCTTCCGCCACCCCCAGGTCGGG + Intergenic
1199451751 X:147985466-147985488 CTTTCCCCCAACCCCTCGACAGG + Intronic
1199470290 X:148187789-148187811 CCTTGCCCCCGCCCCTTGACAGG + Intergenic
1200155739 X:153973992-153974014 GCTTCCCCCAGCGCCTGGCATGG - Intronic