ID: 924983627

View in Genome Browser
Species Human (GRCh38)
Location 2:247104-247126
Sequence CTTTACTTAAAGAATGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924983624_924983627 17 Left 924983624 2:247064-247086 CCAGGAGCAACATTATAAACTGA 0: 1
1: 0
2: 1
3: 16
4: 179
Right 924983627 2:247104-247126 CTTTACTTAAAGAATGTGGAGGG 0: 1
1: 0
2: 2
3: 31
4: 233
924983622_924983627 25 Left 924983622 2:247056-247078 CCACAATCCCAGGAGCAACATTA 0: 1
1: 0
2: 0
3: 13
4: 176
Right 924983627 2:247104-247126 CTTTACTTAAAGAATGTGGAGGG 0: 1
1: 0
2: 2
3: 31
4: 233
924983623_924983627 18 Left 924983623 2:247063-247085 CCCAGGAGCAACATTATAAACTG 0: 1
1: 0
2: 0
3: 7
4: 139
Right 924983627 2:247104-247126 CTTTACTTAAAGAATGTGGAGGG 0: 1
1: 0
2: 2
3: 31
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924983627 Original CRISPR CTTTACTTAAAGAATGTGGA GGG Intronic
902522512 1:17028353-17028375 GTTTAATTAAAGAATTTGAATGG - Intronic
905704810 1:40047065-40047087 CTGTACTTTAAAAATGTGGCCGG - Intronic
907876256 1:58491106-58491128 CTTTTCTTTAAGTATGTTGAAGG - Intronic
909805902 1:79874065-79874087 AATTACTTAAACAATGTGAATGG - Intergenic
913078695 1:115361762-115361784 CTTTTCTTTAAGAATGTTGAGGG - Intergenic
913133864 1:115868210-115868232 GATTACTTACAGAAAGTGGATGG - Intergenic
913431060 1:118790916-118790938 CTTTTCTTTAAGAATGTTGAGGG - Intergenic
914211445 1:145583134-145583156 CTTTTCTTTAAGAATGTTGAAGG - Intergenic
914276649 1:146130561-146130583 CTTTTCTTTAAGAATGTTGAAGG - Intronic
914366165 1:146980613-146980635 CTTTTCTTTAAGAATGTTGAAGG + Intronic
914486279 1:148112812-148112834 CTTTTCTTTAAGAATGTTGAAGG - Intronic
914537694 1:148581516-148581538 CTTTTCTTTCAGAATGTTGAAGG - Intronic
914628231 1:149483829-149483851 CTTTTCTTTAAGAATGTTGAAGG + Intergenic
915697933 1:157763223-157763245 CTTTACTTAAAATATATAGATGG + Intronic
916778213 1:167992217-167992239 CTTTACTGAAAAAATGTGAATGG - Intronic
916921419 1:169471777-169471799 CTTTATTTAACTAATGTTGATGG - Intronic
917777941 1:178358345-178358367 CTTTACTTAAAGTCTATAGATGG - Intronic
918743298 1:188164893-188164915 ATTTACGTAAAGTGTGTGGAAGG + Intergenic
919560331 1:199110234-199110256 CATTATTTAAAGAATGAGGATGG + Intergenic
919702650 1:200647175-200647197 CTTTACTTGAAGAGTTTGTAAGG + Intronic
920866522 1:209758175-209758197 CTTTAAATAAAGAAAGTGGCAGG + Intronic
920880020 1:209871376-209871398 TTCCACCTAAAGAATGTGGATGG - Intergenic
920882257 1:209890991-209891013 CTTTTCTTAATAAATGTAGATGG - Intergenic
921659688 1:217786586-217786608 GTTTTCTTAGAGAAAGTGGATGG + Intronic
921965636 1:221085688-221085710 CTTTACATGAAAAATGAGGATGG + Intergenic
923370294 1:233304320-233304342 CACAACTGAAAGAATGTGGAGGG + Intergenic
923438255 1:233990439-233990461 CTTTACTTAAATAATATTCAGGG + Intronic
924619225 1:245646292-245646314 TTCTACTCAAAGAATGTGGTGGG + Intronic
1068066802 10:52142140-52142162 CTTTAGTTTAAAAATGAGGAAGG + Intronic
1068110174 10:52671086-52671108 CTTTACAGAAAGTATGAGGAAGG + Intergenic
1068124707 10:52825310-52825332 GATTATTTAAAGTATGTGGAAGG + Intergenic
1070872087 10:79764922-79764944 AGTTTCTTTAAGAATGTGGAAGG + Intergenic
1071317736 10:84419211-84419233 CTTTATTTAGACAATGTAGATGG - Intronic
1071639005 10:87287090-87287112 AGTTTCTTTAAGAATGTGGAAGG + Intergenic
1071656233 10:87450860-87450882 AGTTTCTTTAAGAATGTGGAAGG - Intergenic
1073664740 10:105518170-105518192 CTTTGCTTAAAGAGTGTAGCTGG - Intergenic
1074501934 10:114033571-114033593 CTTTGGTTTGAGAATGTGGAGGG - Intergenic
1079793996 11:24775783-24775805 CTTTACTTGAAGCATGTTCAGGG - Intronic
1079892068 11:26068232-26068254 ATTAAATTAAATAATGTGGATGG - Intergenic
1080243004 11:30148546-30148568 CTTTTCTGAAAGAATTTGCAAGG - Intergenic
1084168668 11:67389768-67389790 CTTAACTGAAAGACTGTGTAGGG + Intronic
1084765551 11:71305905-71305927 CTTCAATGAAAGAATGAGGAGGG + Intergenic
1085812947 11:79702140-79702162 CTTTTCTTTAAGAAGGTTGAAGG - Intergenic
1085984010 11:81762986-81763008 CTTTACGTAAAGAATTTGTTAGG + Intergenic
1088304985 11:108398119-108398141 CTTTACTTAAAATATGTTAAGGG - Intronic
1090702346 11:129308158-129308180 CTTAACTTAAAGAGTCAGGAGGG - Intergenic
1091890613 12:4051184-4051206 GTTTACGTAAAGAAAGTGGCAGG - Intergenic
1092799180 12:12146681-12146703 CTTTACTTAAAAAATCTTCAGGG - Intronic
1093709767 12:22317292-22317314 TTTTATTTAATAAATGTGGATGG + Intronic
1093830158 12:23746245-23746267 CTTGACTTTAAAAAAGTGGAAGG + Intronic
1094725346 12:33108454-33108476 ATTTACTTTAAGAATGTTGAGGG - Intergenic
1094804251 12:34072844-34072866 CTTTTCTCTAAGAATGTTGAGGG - Intergenic
1096284421 12:50285927-50285949 CAATACTTAAAGAATGGGCATGG + Intergenic
1096941649 12:55353169-55353191 CTTTGCTTAAAAAATGTTTATGG - Intergenic
1098369546 12:69742010-69742032 CTGTTCTTAAGGAATATGGAAGG + Intronic
1107164048 13:37264981-37265003 CCTTACTTCAAGAATGGGGAGGG + Intergenic
1109007127 13:56892589-56892611 CTTTAATTAAAAAATGTATAAGG + Intergenic
1109129422 13:58562869-58562891 CTTTAGTGAAAGTATGGGGAAGG + Intergenic
1109208064 13:59503940-59503962 CTTTGTTTAAAGAATGTTCAAGG + Intergenic
1109261391 13:60149177-60149199 CCTTCCTGACAGAATGTGGATGG + Intronic
1110351869 13:74518206-74518228 CTTTAATTAAAAAATGATGATGG - Intergenic
1110682547 13:78333480-78333502 CCTTACTAAGAGAATGTGGAGGG - Intergenic
1110700183 13:78537904-78537926 GTATACTTACAGAATGTGAAGGG + Intergenic
1111167509 13:84479565-84479587 TCTTACTTATAGAATGTGCAGGG - Intergenic
1115272510 14:31569567-31569589 CTTTCCTTTGAGGATGTGGATGG + Intronic
1117925583 14:60775886-60775908 CTTTAATTAAAAATTGTAGAAGG + Intronic
1122475840 14:102008359-102008381 AATTACTTAGAGAATGTAGAGGG + Intronic
1122897892 14:104769361-104769383 CTTTTATTGAAGAATTTGGAGGG + Exonic
1123674292 15:22693439-22693461 CATTACGTAATGAATGAGGACGG - Intergenic
1124326303 15:28766429-28766451 CATTACGTAATGAATGAGGACGG - Intergenic
1124837435 15:33209069-33209091 CTTTACTTAAATAAGCTGAAAGG + Intergenic
1125151801 15:36540906-36540928 CTTTGCTGAGATAATGTGGATGG - Intergenic
1126676577 15:51163944-51163966 CTTTGCTTACTGAGTGTGGAGGG + Intergenic
1127346458 15:58105767-58105789 CTTTAAGAAAATAATGTGGAAGG + Intronic
1128064498 15:64755900-64755922 CTTTAGTTAAGGAGTGAGGAAGG - Intronic
1128820790 15:70651072-70651094 CTCTACTTAGAGAACATGGAGGG + Intergenic
1130648157 15:85746476-85746498 CTTTGATTAAAGAATGAGGCGGG - Intronic
1131625666 15:94117660-94117682 CTTTTCTTTAATAATGTGAAAGG - Intergenic
1131959120 15:97769892-97769914 TTTTATTTAAAAAATGTGGCCGG + Intergenic
1134474006 16:14555221-14555243 TTTTATTTAAAAAACGTGGAAGG - Intronic
1137552343 16:49446848-49446870 GTTTTCTTAAAGAATTTGTATGG + Intergenic
1138778360 16:59752851-59752873 CATTACTTTACAAATGTGGATGG + Intronic
1139171020 16:64629042-64629064 CTTTACTTAAGTAATGGGGAGGG - Intergenic
1140858424 16:78998180-78998202 GTTTTCTTAAAGAATGTTGGAGG - Intronic
1141226338 16:82119588-82119610 CTCTGCTTAAAGAAAGGGGAGGG + Intergenic
1141339785 16:83192504-83192526 CTTTTCTCAGAGCATGTGGAGGG - Intronic
1146171447 17:30637307-30637329 CATGAGTTAAAGCATGTGGATGG + Intergenic
1146344908 17:32053330-32053352 CATGAGTTAAAGCATGTGGATGG + Exonic
1149145052 17:53480317-53480339 TTTTACTTAGATAATATGGAGGG - Intergenic
1150729838 17:67682793-67682815 CTTCACTTATAGATTGTGAAAGG - Intronic
1152998277 18:428950-428972 CTTTACTTTAAAAATGTAAAAGG + Intronic
1153594286 18:6708722-6708744 CTTTAATTAAAGAATTGGGGTGG + Intergenic
1155130244 18:22927419-22927441 ATTTACTTAAAGAAGCAGGATGG - Intronic
1156117911 18:33809255-33809277 CTTTACTTTGAGAATCTGGTAGG - Intergenic
1156145299 18:34168395-34168417 CTTTAGTTAAAGTCTGTGAATGG - Intronic
1156851651 18:41735139-41735161 CTCTAATTAAGGAATGTGCAAGG - Intergenic
1158394316 18:57067858-57067880 CTTTTCTTGAAGATTGAGGATGG + Intergenic
1159403915 18:67975510-67975532 CTTTACTTTAAGTCTATGGATGG + Intergenic
1160308153 18:77760675-77760697 CTTGAGTTTAAGATTGTGGATGG + Intergenic
1160433667 18:78829922-78829944 CCTAACTTCAAGAATGTGCATGG - Intergenic
1163195087 19:15713254-15713276 AGTTATTTAGAGAATGTGGAAGG + Intergenic
1165532674 19:36417554-36417576 CTTTTCTTAAAGAATTGGGCAGG + Intronic
924983627 2:247104-247126 CTTTACTTAAAGAATGTGGAGGG + Intronic
928513611 2:32025161-32025183 CTTTACTTAAAAAATGTATTTGG + Intronic
928633035 2:33213843-33213865 ATTTATTTAAACAATTTGGATGG + Intronic
930257632 2:49110255-49110277 TTGTACTTATAAAATGTGGATGG - Intronic
930286771 2:49439699-49439721 CTTAACATAAAGTATGTGGTAGG - Intergenic
930957754 2:57224535-57224557 CCTTAATTAAATAATGTAGAAGG - Intergenic
931914777 2:66942148-66942170 CTTTTCGTTAAGAATATGGATGG + Intergenic
932023023 2:68107301-68107323 ATTTACTTAGAAAATGTGCATGG - Intronic
932119787 2:69088014-69088036 CTTAACTTAAAACATCTGGAAGG - Intronic
932168538 2:69531866-69531888 CTTTAAGTGAAGAATGAGGAGGG - Intronic
933472950 2:82750279-82750301 ATTTTCTTTAAGAATGGGGAAGG - Intergenic
933528365 2:83473182-83473204 GTTTACTTTAAAAATGTGTATGG + Intergenic
935387606 2:102516836-102516858 CTTTAATTAAAAAATGTGTAAGG - Intronic
935713898 2:105922911-105922933 TTTTATTAATAGAATGTGGAGGG - Intergenic
936840992 2:116768463-116768485 CCTTTCTTAAAAAATGTTGAAGG + Intergenic
936923640 2:117714580-117714602 ATTTACTTAAAGAAGGTGGAGGG - Intergenic
938205179 2:129415359-129415381 CTTTTCTTTAAGAATGTTGAGGG + Intergenic
940519162 2:154720899-154720921 CACTACTTAGAGAATGTAGAAGG + Intronic
942957898 2:181795465-181795487 GTTTACTTAAAAAATGTGTTGGG + Intergenic
943347521 2:186757056-186757078 CTATACTTGAGGAATGTTGATGG + Intronic
943859279 2:192839148-192839170 ATTTACTGAAAGAATTTGAAGGG - Intergenic
945317430 2:208385058-208385080 CTGTACTTTAAGAAAATGGATGG + Intronic
946000807 2:216480702-216480724 CTCTACTTCACCAATGTGGAGGG + Intronic
948271797 2:236679829-236679851 CTGTGGTCAAAGAATGTGGATGG - Intergenic
1169313118 20:4564626-4564648 CTTGACTTTAAGAATGTTGATGG + Intergenic
1169953173 20:11070936-11070958 CTTAAATTAAGGAATGAGGAAGG - Intergenic
1170196019 20:13690347-13690369 TTTTTCTTAAAGAATTTTGAGGG + Intergenic
1172356155 20:34281412-34281434 CTTGAGTTGAAGAATGAGGAAGG - Intronic
1173968756 20:47134031-47134053 CATTTCTTAAGGAATGTGCAGGG + Intronic
1174884343 20:54315780-54315802 CTCTAGGCAAAGAATGTGGATGG + Intergenic
1175665040 20:60851440-60851462 TTTTACTTGAACAATGTGGGAGG + Intergenic
1177787883 21:25692022-25692044 ATTTACATACATAATGTGGAAGG + Intronic
1178155325 21:29846686-29846708 CTCTGCTTAAAGAATGAGAAGGG + Intronic
1179300595 21:40105762-40105784 CTATTCTTTAAGAAAGTGGAAGG - Intronic
1180134232 21:45851211-45851233 CTTTGGTTAAAGAAAGTGGAAGG + Intronic
1180609578 22:17086332-17086354 ATTTACCGAAAGAAGGTGGAGGG + Intronic
1182637155 22:31737173-31737195 CATTCCTTTAAGAATTTGGAGGG + Intronic
952580091 3:34823296-34823318 CTTTAAATAAATAATGTTGAGGG + Intergenic
953121525 3:40047432-40047454 TTTTATTTTAAGAAAGTGGAGGG + Intronic
953433597 3:42859679-42859701 CTTCTCTTTAAGAATGTTGAAGG - Intronic
953597377 3:44330315-44330337 GTTTACTTATTGAATTTGGAAGG + Intronic
953805525 3:46064529-46064551 CTTGACTGATAGAATGTGGCTGG + Intergenic
956279605 3:67542172-67542194 CTTTTCTTTAAGAATGTTGAGGG - Intronic
959126857 3:102300288-102300310 CTTCACTAAAAGAATCTGGTAGG - Intronic
959723789 3:109521747-109521769 CTTTCCTTTAAGAATGTTGGGGG + Intergenic
960646552 3:119891171-119891193 TTTTACTTAAGGAATGTAGCAGG + Intronic
962134152 3:132715982-132716004 CTTGATTTAAAGAATATGGGAGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963323212 3:143832506-143832528 GTTTTCTTAAAGTATTTGGATGG - Intronic
963371305 3:144404189-144404211 TTTTAGTTCAAGAATTTGGAAGG + Intergenic
964484012 3:157168833-157168855 CTTTACTTGAAGAATCTCTAAGG - Intergenic
964630071 3:158801054-158801076 CTTTACTAACAGAATTTTGAGGG - Intronic
964831453 3:160887875-160887897 CTTTTCTTTAAGAATGTTGGAGG - Intronic
964939784 3:162143802-162143824 CTTTATTTAAAGAGGGAGGAAGG - Intergenic
966594889 3:181716989-181717011 CTTTATTTAAAGTATGTGGTGGG - Intergenic
967256547 3:187598609-187598631 CTTTCTTTAAAGGATGTTGAAGG - Intergenic
967528988 3:190527748-190527770 CTTTACTTGGAAAATGTAGAAGG - Intronic
970527962 4:16951532-16951554 CTTTACTCAAAATATGTAGAGGG + Intergenic
970998613 4:22296648-22296670 CTTGACTTAAACCATGTGTAAGG + Intergenic
972291531 4:37694271-37694293 ATTTACTGAGAGAATTTGGAGGG + Intergenic
972647073 4:40979115-40979137 CTCTAGTTTAAGAATCTGGAAGG + Intronic
972734015 4:41822570-41822592 TTTTCCCTATAGAATGTGGAGGG + Intergenic
973231066 4:47838899-47838921 CTTTCTTTAAATAATGGGGATGG - Intergenic
973877505 4:55234915-55234937 CTTTTCTTTACGAATGTTGAGGG + Intergenic
973895178 4:55405062-55405084 CTTTATTCAAAGAAGGTGGAGGG - Intronic
974303688 4:60103775-60103797 ATTTATTTAATAAATGTGGATGG + Intergenic
976719572 4:88156613-88156635 TTTTAATTAAAAAATGTAGAAGG + Intronic
977384133 4:96316786-96316808 CTTTACTTAAATGATATTGACGG + Intergenic
977739814 4:100465705-100465727 ATTACTTTAAAGAATGTGGAGGG + Intronic
978326042 4:107557102-107557124 CTTTATTTAAAGAATTTGGATGG + Intergenic
979299280 4:119068112-119068134 CTTTACTTTAAGAATGAGGCTGG + Intergenic
981807332 4:148732053-148732075 CTTTACTTAAAGTCAATGGATGG - Intergenic
982358993 4:154498441-154498463 CTCGACCTAAAGAATCTGGATGG - Intergenic
984151455 4:176137977-176137999 CTTCACCTAAAAAATGTTGAAGG + Intronic
984953463 4:185023354-185023376 ACTTACTTAAAGAAAGTGGAGGG - Intergenic
987571029 5:19659188-19659210 ATTTAATTATAGAATGTAGAAGG - Intronic
988050890 5:26029890-26029912 GCTTACTTAAAAAATGTGGCTGG + Intergenic
989253103 5:39338625-39338647 ATTTAATTAAAAAATGTTGATGG + Intronic
990344473 5:54857875-54857897 TTGAACGTAAAGAATGTGGAAGG + Intergenic
991114206 5:62935244-62935266 ATTTACGTAAAGAAAGGGGAAGG - Intergenic
991242002 5:64470923-64470945 CTTTTCTTTAAGAATGTTGAGGG - Intergenic
991500085 5:67268202-67268224 ATTTATTTCAAGAATGCGGAGGG - Intergenic
993034143 5:82738440-82738462 TTTTACTTAAAGGATGAGGTGGG + Intergenic
993326300 5:86542208-86542230 TTTTACATAAAGAAATTGGAGGG - Intergenic
993596465 5:89862794-89862816 CTCTAGTTAAAGAGTTTGGAGGG - Intergenic
995809204 5:116085704-116085726 TTTTACTTAAATAATGTTAAAGG - Intronic
998976683 5:147656977-147656999 ATTTTCTTTAAGAATGTTGATGG + Intronic
999566350 5:152866849-152866871 CTTTTCTTAAAGAAATTGAAAGG - Intergenic
1000880522 5:166692048-166692070 GTTTATTTCAAGTATGTGGAAGG + Intergenic
1000934859 5:167295199-167295221 CTCTACTTAGAAAATGTGGATGG + Intronic
1001749719 5:174119437-174119459 GCTTACTTAAGGAATGTGGCAGG - Intronic
1002972933 6:2042895-2042917 CTTTACCTAAACATTTTGGAGGG - Intronic
1004791348 6:19029902-19029924 CATGAATTATAGAATGTGGAAGG - Intergenic
1005466478 6:26120827-26120849 CCTTACTTAAAGAACGTGAAGGG + Intronic
1008181944 6:48342209-48342231 CTCTACTGAGAGAATATGGAAGG + Intergenic
1008229403 6:48965846-48965868 ATTTAGTGAAAGAATGGGGAGGG + Intergenic
1008536909 6:52513298-52513320 CATTACTTTAAAAATGTTGAAGG + Intronic
1010882380 6:81194037-81194059 ATTTACTTACATAATGTGGAAGG - Intergenic
1010906973 6:81502494-81502516 CTTTACTAGAAGAATGAGAATGG + Intronic
1010991262 6:82482845-82482867 CTTTATTTAAAGAATTTACAGGG - Intergenic
1011675317 6:89727671-89727693 GTTTTCTTTAAGAATGAGGAAGG - Intronic
1012782975 6:103586628-103586650 CTTTCCATAAAGAATGTCCATGG + Intergenic
1014308905 6:119774105-119774127 CTTAACTTCAAGAATCTTGAGGG + Intergenic
1015327227 6:131936940-131936962 CTTTATTGAAAGAATGTCTATGG + Intergenic
1016054694 6:139566620-139566642 CTCTACTTAAAAAGTGTGGAGGG - Intergenic
1016930377 6:149400817-149400839 GTATAATAAAAGAATGTGGAAGG - Exonic
1016970665 6:149759198-149759220 CTGTACTGAAAAAATGTGAAAGG - Intronic
1017135460 6:151143561-151143583 CTTTACGAAAAGAATGTGATGGG - Intergenic
1017585092 6:155911617-155911639 CTTTAAGTAAAGAATGTAGGTGG - Intergenic
1017949379 6:159123110-159123132 CTCTCTTTAAATAATGTGGAAGG + Intergenic
1018217794 6:161547451-161547473 CCTTGCTTTAAGAATGTTGAAGG - Intronic
1018646419 6:165952793-165952815 ATTTACTTAAGCAAAGTGGATGG - Intronic
1020363015 7:7350045-7350067 TTTATCTTAAAGAATATGGAGGG + Intergenic
1021665515 7:22974289-22974311 CTTTTGTTAAATAATGTTGATGG + Intronic
1021916800 7:25442368-25442390 TTTTTCTTTAAGAATGCGGAGGG + Intergenic
1024464766 7:49700588-49700610 CTTTACTTACAGGATGCTGAGGG + Intergenic
1025854679 7:65266857-65266879 CTTTAGGTAAAAAAGGTGGAGGG + Intergenic
1029203869 7:98856824-98856846 ATTTACTTGAAAAATCTGGATGG - Intronic
1029498853 7:100915090-100915112 CTCCACTTAAAGAAAGTGGTGGG - Intergenic
1031470304 7:122160484-122160506 CTTTTATTAAAGATGGTGGATGG - Intergenic
1033042207 7:137928796-137928818 CTTGACCAAAAGAATGTGGAGGG - Intronic
1033529709 7:142249365-142249387 CTGAACTTAAAGAATGTGATTGG + Intergenic
1036776993 8:11620426-11620448 TTTAACTTAATGAATTTGGAGGG + Intergenic
1037682463 8:21108828-21108850 CTTTACTTTGAGAATGCTGATGG + Intergenic
1039336363 8:36594807-36594829 AGTTACTTACAGAGTGTGGATGG - Intergenic
1040730582 8:50442347-50442369 CTTCACTTAAAGACAGTGGAGGG - Intronic
1040773230 8:51005596-51005618 CATTACTGAAAGCATGTTGATGG - Intergenic
1041290036 8:56300050-56300072 CATTACTCAAAGAATGATGAAGG - Intronic
1041610208 8:59837345-59837367 CTGTACTTAAAAAATGTAAATGG - Intergenic
1042446137 8:68887274-68887296 ATTTGTTTAAAGTATGTGGAAGG + Intergenic
1044438749 8:92197760-92197782 CATTACCTAAAGAATATGAAAGG + Intergenic
1044629812 8:94267258-94267280 GTTTAATGAATGAATGTGGATGG - Intergenic
1045037750 8:98189412-98189434 CTTTACTTAAACTCTGTGGCTGG - Intergenic
1045045175 8:98268133-98268155 CTTTTCATAAAGAATGCTGAAGG + Intronic
1045860917 8:106814310-106814332 CTTTACATAAAGAGTGCAGAAGG - Intergenic
1046604615 8:116357265-116357287 CTTTACTTAAAGTTTTTGGTGGG - Intergenic
1047121899 8:121913978-121914000 CCTAACTTATAGAAAGTGGAAGG - Intergenic
1047653275 8:126947759-126947781 CTTTTCCTGAAGGATGTGGAGGG + Intergenic
1047919309 8:129617458-129617480 CTCTAGTCAAAGAATGTGGGTGG + Intergenic
1048778035 8:137969212-137969234 CAATACTTAAAGAATATGAAAGG - Intergenic
1050862086 9:10447738-10447760 TCTTACTTGAAGAATGAGGAAGG - Intronic
1052638033 9:31127761-31127783 CTTAACTTCAAGAAGGTGGGGGG - Intergenic
1052674358 9:31600425-31600447 TTTTACAGAAAGAATGTGAAAGG + Intergenic
1052987685 9:34500159-34500181 TCTAACTTAAAGAAAGTGGAAGG + Intronic
1054942248 9:70755665-70755687 CTTTTCTTTAAGAATGTCGATGG - Intronic
1056726364 9:89122629-89122651 TTTAACTAATAGAATGTGGAGGG - Intronic
1057014538 9:91639869-91639891 CTTCACTGAAAGAGTCTGGAAGG + Intronic
1058489676 9:105483680-105483702 ATTTACTAGATGAATGTGGAGGG - Intronic
1058772977 9:108256533-108256555 TTTTAATTAAAAAATGTGTATGG + Intergenic
1061591423 9:131600137-131600159 CTTCAGTAAAAGAATATGGATGG + Intronic
1186950292 X:14617040-14617062 CTTTAGTTTAAGAATGTTGTTGG + Intronic
1188828289 X:34864427-34864449 CTTTTTTTAAAAAATCTGGATGG + Intergenic
1191703750 X:64070950-64070972 TTTTACTTAAGAAAAGTGGAAGG + Intergenic
1194324370 X:92494508-92494530 CTTTCCTGAAACAAAGTGGAAGG - Intronic
1194359312 X:92929313-92929335 CTCAACTCAAGGAATGTGGATGG - Intergenic
1195870648 X:109481673-109481695 CTTGACTTAAAGTATCTCGAAGG + Intronic
1196428207 X:115593870-115593892 CTTTATTTAGAGAATGTTTAGGG + Intronic
1196972526 X:121125096-121125118 TTTTACTTAAAGAATGAGGTAGG + Intergenic
1197173633 X:123461928-123461950 GTTTACTGATAGAATGTAGAAGG + Intronic
1198006243 X:132497433-132497455 CATTAGTGAGAGAATGTGGAAGG + Intergenic
1198476888 X:137003447-137003469 TTTTAATTGAAGCATGTGGACGG + Intergenic
1198684820 X:139216799-139216821 CTTTATTGAAAGATTGTGGCCGG - Intronic
1198833964 X:140781760-140781782 CTTTACTTAAAAAAAATGGTTGG - Intergenic
1199590456 X:149463156-149463178 CTTTAGCTAAAGAATGTGAGTGG - Intergenic
1200667507 Y:6045148-6045170 CTCAACTCAAGGAATGTGGATGG - Intergenic