ID: 924985237

View in Genome Browser
Species Human (GRCh38)
Location 2:264384-264406
Sequence CTCGCGCACGTGGCGGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924985237_924985242 4 Left 924985237 2:264384-264406 CCACAGCCCGCCACGTGCGCGAG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 924985242 2:264411-264433 GCGCTGTGCCCCAACCCAGGTGG 0: 1
1: 0
2: 3
3: 18
4: 151
924985237_924985251 25 Left 924985237 2:264384-264406 CCACAGCCCGCCACGTGCGCGAG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 924985251 2:264432-264454 GGGCGGCCCGCGGAGCCGCGAGG 0: 1
1: 0
2: 5
3: 40
4: 341
924985237_924985243 5 Left 924985237 2:264384-264406 CCACAGCCCGCCACGTGCGCGAG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 924985243 2:264412-264434 CGCTGTGCCCCAACCCAGGTGGG 0: 1
1: 0
2: 2
3: 15
4: 133
924985237_924985244 8 Left 924985237 2:264384-264406 CCACAGCCCGCCACGTGCGCGAG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 924985244 2:264415-264437 TGTGCCCCAACCCAGGTGGGCGG 0: 1
1: 0
2: 0
3: 22
4: 174
924985237_924985248 15 Left 924985237 2:264384-264406 CCACAGCCCGCCACGTGCGCGAG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 924985248 2:264422-264444 CAACCCAGGTGGGCGGCCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 130
924985237_924985241 1 Left 924985237 2:264384-264406 CCACAGCCCGCCACGTGCGCGAG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 924985241 2:264408-264430 CTCGCGCTGTGCCCCAACCCAGG 0: 1
1: 0
2: 0
3: 13
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924985237 Original CRISPR CTCGCGCACGTGGCGGGCTG TGG (reversed) Intronic
900360950 1:2288865-2288887 CTCACACACGTGGCGGGGGGAGG - Intronic
903879827 1:26500974-26500996 CGCGCGCACGTGCCGGGGCGGGG + Intergenic
904354044 1:29927003-29927025 CTGGTGCAGGTGGTGGGCTGGGG - Intergenic
904611945 1:31730869-31730891 CTCGGGCACTTGGCGGGCGCTGG + Exonic
905442798 1:38005586-38005608 CTGGCCCCCGCGGCGGGCTGGGG - Intronic
910183060 1:84506278-84506300 CTCGCGCTCGGGGCCGGGTGTGG - Exonic
911606685 1:99914031-99914053 CTCACACACTTGGCGGACTGAGG + Intronic
913518271 1:119623312-119623334 CGCGCGCACGCGGCGGCCAGCGG - Exonic
915225050 1:154405725-154405747 CGGGCGCACCTGGAGGGCTGGGG + Intronic
920043316 1:203117739-203117761 CTCGGGCAGGTGGGGAGCTGAGG + Intronic
920922638 1:210311132-210311154 CGCGCGCACGTGGCGGGGGGGGG - Intergenic
924534077 1:244918916-244918938 CGCGCGCACGTGGCGCGGTGTGG - Intergenic
1069902202 10:71712832-71712854 CTGGGGCAGGTGGTGGGCTGGGG + Exonic
1074756448 10:116627582-116627604 CCCGCGCACGAGCCGGCCTGCGG + Intronic
1077239513 11:1503209-1503231 CTCGCGCCCATGTCTGGCTGCGG - Intergenic
1084412081 11:69011122-69011144 CGGGGGCACGTGGCTGGCTGAGG - Intronic
1087214603 11:95481931-95481953 CGCAGGCACGCGGCGGGCTGAGG - Intergenic
1090211019 11:124921194-124921216 CTCGCGCACACTGCGGACTGCGG - Exonic
1091498291 12:991193-991215 CTCGCGCAGGGGGCGGGGCGCGG + Intronic
1106516908 13:30464541-30464563 CGGGCGCACGTGGCGGCCTCGGG - Intronic
1112580793 13:100674876-100674898 CCCGCGCGCGTGGGGAGCTGCGG - Intronic
1113899199 13:113787172-113787194 CGCGTGCACGTGGCTGACTGTGG - Intronic
1130516690 15:84631242-84631264 CTCGCGCACCTGGGAGGGTGTGG - Intergenic
1131094782 15:89648372-89648394 GTCGCGCACCTTGCGGGCGGCGG + Exonic
1132580823 16:683959-683981 CGCGCGCACGCGTGGGGCTGGGG - Intronic
1132765208 16:1531033-1531055 CTCGAGCAGGAGGCTGGCTGTGG - Intronic
1134538506 16:15045778-15045800 TTCGCCCACTTGACGGGCTGTGG - Intronic
1136396568 16:29995677-29995699 CTCGCGCACGCGCAGTGCTGCGG + Exonic
1141949230 16:87330079-87330101 CTCGGGCACGGAGCTGGCTGTGG + Exonic
1145214461 17:21042037-21042059 CTGGGGCAGGAGGCGGGCTGGGG - Intronic
1147339034 17:39742956-39742978 TTCACACACGTGGCGAGCTGTGG - Exonic
1151218254 17:72592392-72592414 CTCGCGGAGGTCGCGGGCGGGGG + Intergenic
1151370174 17:73642886-73642908 CTGGCGCACGAGGCGGCGTGGGG + Intronic
1153900656 18:9614611-9614633 CGCGCGCGCGGGGCGGGCCGAGG + Intronic
1159511190 18:69400649-69400671 CTCGCGCCCGGGGAGCGCTGAGG + Intergenic
1160921676 19:1523757-1523779 CTCTCGCGCGTGGGGGGTTGGGG - Intergenic
1161220960 19:3117941-3117963 CTCGCGCTCCAGACGGGCTGTGG + Intronic
1162573738 19:11486910-11486932 CTCCCGCACCAGGCAGGCTGGGG + Intronic
1163210619 19:15837083-15837105 CCGGGGGACGTGGCGGGCTGTGG - Intergenic
1163681264 19:18683893-18683915 CGCGTGCACGGGGCGGGGTGGGG + Intronic
924985237 2:264384-264406 CTCGCGCACGTGGCGGGCTGTGG - Intronic
926405627 2:12549500-12549522 CCCACGCACATGGCGGGCTCTGG - Intergenic
931338662 2:61376579-61376601 CTCGCGGAGGTGGAGGGGTGAGG + Intronic
932331340 2:70900117-70900139 CTCGGGCGCTTGGCGGGGTGGGG - Intergenic
932568484 2:72924303-72924325 CTGGGGCACGTCGCTGGCTGCGG - Exonic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
941141855 2:161793433-161793455 CTGGGGCACTTGGGGGGCTGAGG - Intronic
943101791 2:183495780-183495802 CTGGCCCACTTGGAGGGCTGTGG + Intergenic
943333830 2:186590243-186590265 CGCGCGCAGGCGGCGGGCCGCGG + Exonic
948047033 2:234952445-234952467 CGAGCGCACGCGGAGGGCTGCGG - Intronic
1169204603 20:3732690-3732712 CGGGCGCACGTCGAGGGCTGCGG + Exonic
1171455999 20:25272741-25272763 CTCAGGCACGCGGAGGGCTGGGG - Intronic
1175926901 20:62475650-62475672 CCCGCGAACGTCCCGGGCTGGGG - Intronic
1176223181 20:63979563-63979585 CTCGGGCGCGGGGCCGGCTGGGG - Exonic
1179522515 21:41954145-41954167 CGCGCGCACGTGGCGGGGCCGGG - Intergenic
1180132304 21:45834576-45834598 CTCGTGGACGTGGTGGCCTGGGG - Intronic
1180209594 21:46286581-46286603 CGCGCGGACGCGGCGGGGTGCGG - Exonic
1180832835 22:18914820-18914842 CTTGAGCACGTGGTGGGCTCAGG - Intronic
1180876898 22:19178833-19178855 GGCCCGCACGGGGCGGGCTGGGG - Intergenic
1181066986 22:20311432-20311454 CTTGGGCACGTGGTGGGCTCAGG + Intergenic
1181277933 22:21698494-21698516 CTCGCACCCGTGGCAGGCTGGGG + Exonic
1181631895 22:24155978-24156000 CTCTCGCTCGCGGCGGGCCGGGG - Intronic
1182782738 22:32881003-32881025 CTCACCCACGTGGTGGCCTGGGG + Intronic
1183523937 22:38312887-38312909 CTCACTCATGTGGAGGGCTGTGG + Intronic
1185040175 22:48499823-48499845 GTCGTGCATGTGGTGGGCTGGGG + Intronic
1203282920 22_KI270734v1_random:140124-140146 CTTGAGCACGTGGTGGGCTCAGG - Intergenic
967106895 3:186261436-186261458 ATGGCTCACGTGGCAGGCTGTGG + Intronic
967316278 3:188154309-188154331 CTCGCGCCGGGGGAGGGCTGGGG - Intronic
968428367 4:537715-537737 CTGGAGCACATGGCGGGCTGAGG + Intronic
990557517 5:56951491-56951513 CTCCCGCACCTCCCGGGCTGCGG + Intronic
997912422 5:137889297-137889319 CTTTCGCCCGAGGCGGGCTGCGG - Intronic
1002424587 5:179167635-179167657 CTCGGTCGCGTGGCGGCCTGCGG - Intronic
1002896352 6:1382547-1382569 CTCGCACACCAGACGGGCTGCGG - Intergenic
1003098049 6:3157455-3157477 CTCGCGCATGGTGCCGGCTGCGG + Exonic
1005328152 6:24721618-24721640 CCTGCGCACGTGGCGGGGTGGGG - Intergenic
1005385254 6:25279315-25279337 CTCGCGCTCCTGCCGGGCTCCGG - Intronic
1013298688 6:108782488-108782510 CGCCCGCACGTGGCGTTCTGCGG + Intergenic
1014847605 6:126297862-126297884 CTTGCTCACATGGCTGGCTGTGG + Intergenic
1017426110 6:154323183-154323205 CTCGTGCACGTGGAGATCTGGGG - Intronic
1019631994 7:2054308-2054330 CGGGCGCACGTGGAGGGCTCGGG + Intronic
1022164148 7:27740883-27740905 CTTGCGAACGGGGCGGGGTGGGG - Intronic
1026736964 7:72954851-72954873 ATCGCGCACCTGCCGGGCTAGGG + Intergenic
1027106768 7:75410212-75410234 ATCGCGCACCTGCCGGGCTAGGG - Intronic
1038540399 8:28386003-28386025 CTGCCGCTCGTGGCGGGCCGAGG - Intronic
1049746871 8:144266734-144266756 CGCGTGCACGCGGCGCGCTGCGG + Exonic
1049798854 8:144508672-144508694 AGCGCGCACGTGGCGGGGCGGGG + Intergenic
1195668297 X:107449756-107449778 GGCGCGCAGGCGGCGGGCTGCGG - Intergenic
1198398783 X:136250755-136250777 CTCGCCCACGACCCGGGCTGGGG + Intronic
1200254520 X:154572876-154572898 CTCCCGCACCTAGCGGGCGGTGG + Intergenic
1200263249 X:154631532-154631554 CTCCCGCACCTAGCGGGCGGTGG - Intergenic