ID: 924985237

View in Genome Browser
Species Human (GRCh38)
Location 2:264384-264406
Sequence CTCGCGCACGTGGCGGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924985237_924985243 5 Left 924985237 2:264384-264406 CCACAGCCCGCCACGTGCGCGAG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 924985243 2:264412-264434 CGCTGTGCCCCAACCCAGGTGGG 0: 1
1: 0
2: 2
3: 15
4: 133
924985237_924985242 4 Left 924985237 2:264384-264406 CCACAGCCCGCCACGTGCGCGAG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 924985242 2:264411-264433 GCGCTGTGCCCCAACCCAGGTGG 0: 1
1: 0
2: 3
3: 18
4: 151
924985237_924985241 1 Left 924985237 2:264384-264406 CCACAGCCCGCCACGTGCGCGAG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 924985241 2:264408-264430 CTCGCGCTGTGCCCCAACCCAGG 0: 1
1: 0
2: 0
3: 13
4: 154
924985237_924985251 25 Left 924985237 2:264384-264406 CCACAGCCCGCCACGTGCGCGAG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 924985251 2:264432-264454 GGGCGGCCCGCGGAGCCGCGAGG 0: 1
1: 0
2: 5
3: 40
4: 341
924985237_924985244 8 Left 924985237 2:264384-264406 CCACAGCCCGCCACGTGCGCGAG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 924985244 2:264415-264437 TGTGCCCCAACCCAGGTGGGCGG 0: 1
1: 0
2: 0
3: 22
4: 174
924985237_924985248 15 Left 924985237 2:264384-264406 CCACAGCCCGCCACGTGCGCGAG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 924985248 2:264422-264444 CAACCCAGGTGGGCGGCCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924985237 Original CRISPR CTCGCGCACGTGGCGGGCTG TGG (reversed) Intronic