ID: 924985266

View in Genome Browser
Species Human (GRCh38)
Location 2:264485-264507
Sequence GAGGGGTACCTGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 875
Summary {0: 1, 1: 0, 2: 14, 3: 95, 4: 765}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924985266_924985282 20 Left 924985266 2:264485-264507 CCTTCCTCCTCCAGGTACCCCTC 0: 1
1: 0
2: 14
3: 95
4: 765
Right 924985282 2:264528-264550 TAGGTAACCTTTACCTCCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 38
924985266_924985275 1 Left 924985266 2:264485-264507 CCTTCCTCCTCCAGGTACCCCTC 0: 1
1: 0
2: 14
3: 95
4: 765
Right 924985275 2:264509-264531 CCTGCGGCCCCGTCCCCTATAGG 0: 1
1: 0
2: 0
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924985266 Original CRISPR GAGGGGTACCTGGAGGAGGA AGG (reversed) Intronic
900152221 1:1183669-1183691 GAGGGCTGCCTGGAGGAGGAGGG - Intronic
900166094 1:1244908-1244930 GAGGGGGAAGAGGAGGAGGAGGG - Intronic
900516357 1:3084108-3084130 GTGGGCTCCCTGGAGGAGAAAGG + Intronic
900531745 1:3157159-3157181 GGGCGGGACCTGGAGAAGGAGGG + Intronic
900618113 1:3574428-3574450 AAGGGCTTCCTGGAGGAGGTGGG - Intronic
900624529 1:3602206-3602228 GAGGGGTGTGTGGAGGAGGAGGG - Intronic
900640230 1:3684974-3684996 GAAGGGGACCTGGAGGGGGTGGG - Intronic
900700803 1:4047556-4047578 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
900968478 1:5975993-5976015 GAGGGGTTGAGGGAGGAGGAGGG + Intronic
901230088 1:7636983-7637005 GAAGGCTTCCTGGAAGAGGAGGG + Intronic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901438860 1:9265404-9265426 GAGGGGCAGCTGGGGAAGGAGGG - Exonic
902081971 1:13827374-13827396 GAAAGCTTCCTGGAGGAGGAGGG + Intergenic
902155622 1:14483283-14483305 CAGGGTTGCATGGAGGAGGAGGG - Intergenic
902223358 1:14980878-14980900 GTGGGGTGGCTGGAGGAGGCTGG + Intronic
902411244 1:16212661-16212683 GAGGGGGAGGTGAAGGAGGAGGG + Intergenic
902726693 1:18340941-18340963 GAGGGGGAGGGGGAGGAGGACGG - Intronic
902759727 1:18573295-18573317 GAGGGCTCCCTGGAAGAGGAGGG - Intergenic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
903293102 1:22326986-22327008 GAAGGCTTCCTGGAGGAGGCAGG - Intergenic
903326830 1:22573664-22573686 GAGGAGGAGCTGGAGGATGAGGG - Intronic
903557348 1:24203304-24203326 GAGGGGTACATGGAAGGAGATGG - Intergenic
903797467 1:25940529-25940551 GAGGGGTCCCTGGCGCAGGCAGG - Intergenic
904034843 1:27553008-27553030 GGGTGGTACCTGGAGGAGGCTGG - Intronic
904037191 1:27565220-27565242 TAGGGGTGCCTGGGGGAGGCAGG - Intronic
904286146 1:29454279-29454301 GATGGGTGCCTGGGTGAGGATGG + Intergenic
904380776 1:30109276-30109298 GGGTGGTCCCTGGAGGGGGATGG - Intergenic
904499252 1:30904776-30904798 GAAGGCTTCCTGGAGGAGGAGGG - Intronic
904756259 1:32770404-32770426 CAGGTGTCACTGGAGGAGGATGG - Exonic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
904894134 1:33801436-33801458 GAGGAGGCCCTGGAGGAAGAAGG + Intronic
904998384 1:34649015-34649037 GATGGCTTCCTAGAGGAGGAGGG - Intergenic
905217737 1:36421321-36421343 GAGTGTTCCCGGGAGGAGGATGG - Intronic
906156211 1:43615469-43615491 GAAGGCTTCCTGGAGGAGGAGGG - Intronic
906704652 1:47886202-47886224 GAGGGCTCCCTGGAGGAGGTGGG - Intronic
906829949 1:49020593-49020615 GGGGGTGTCCTGGAGGAGGAGGG + Intronic
907403202 1:54238404-54238426 GAGGCCTGCATGGAGGAGGAAGG + Intronic
907476542 1:54709747-54709769 GAAGGCTTCCTGGAGGAGGCAGG + Intronic
908746345 1:67380342-67380364 GAAGGCTTCCTGAAGGAGGAAGG - Intronic
909977712 1:82064713-82064735 AAGGGGTCACTGGATGAGGATGG - Intergenic
910793041 1:91070756-91070778 GAGGGGTACTTAAAGGAGAAAGG + Intergenic
911048417 1:93648811-93648833 GAGGGCTTCCTGGAGGAGGTTGG - Intronic
912516329 1:110218789-110218811 GTGGGGTTGGTGGAGGAGGATGG + Intronic
912546506 1:110455224-110455246 GAGGGGTACATGTAGGGAGAGGG - Intronic
912975910 1:114330111-114330133 GAAGGGTGCTTTGAGGAGGAAGG - Intergenic
913148655 1:116017788-116017810 GAAGGGGACCAGGAAGAGGAAGG + Intronic
913650908 1:120913174-120913196 GAGGAGGAGGTGGAGGAGGAGGG - Intergenic
914525322 1:148459859-148459881 GAGGAGGAGGTGGAGGAGGAGGG + Intergenic
914598351 1:149175971-149175993 GAGGAGGAGGTGGAGGAGGAGGG - Intergenic
914641078 1:149607269-149607291 GAGGAGGAGGTGGAGGAGGAGGG - Intergenic
914681163 1:149939186-149939208 GAGGGGCAGCCGGAGGAGGGAGG + Exonic
915913507 1:159928468-159928490 GAGGGGTTTCTGGAGAACGAAGG + Exonic
916223152 1:162464578-162464600 AAGGGGAACCTAAAGGAGGAGGG - Intergenic
917962859 1:180158205-180158227 GAGAGGTGGGTGGAGGAGGAAGG + Intronic
917969042 1:180195642-180195664 GAGGGGTACTTGGAAGAGTCAGG - Intronic
918002943 1:180514609-180514631 GGGGGGGACGAGGAGGAGGAGGG + Intergenic
920068056 1:203283015-203283037 GCAGGGTACCTGGAGCATGAGGG - Intergenic
920295676 1:204954710-204954732 AAGGGGCACCTGGAGAAGGAGGG - Intronic
921099230 1:211913895-211913917 GAGGCGCACATGGAGGAGAATGG + Intergenic
921245607 1:213235976-213235998 GACGGGTACCTGGAGGTGAGTGG + Intronic
922068200 1:222164949-222164971 GTGGGGTGCTTGGAGGAAGAGGG + Intergenic
922187975 1:223293206-223293228 TAGGGGTAAGAGGAGGAGGAAGG - Intronic
922279895 1:224114022-224114044 AAGGGGTACCTGGAGGAGTGGGG - Intergenic
922336040 1:224618565-224618587 GAGGGGAAACTCGGGGAGGAAGG + Intronic
922345965 1:224696592-224696614 AAGTGGGACCTGGAGGAGGCTGG + Intronic
922427705 1:225514802-225514824 GAGGGGGCCCTGGGGGAGGAGGG + Exonic
922562902 1:226582017-226582039 GAGGGAGAGCTGGAAGAGGAGGG - Intronic
923018878 1:230147711-230147733 GAGGGACTCTTGGAGGAGGAAGG - Intronic
923216192 1:231850194-231850216 GAGGGGTCCCTGGATGATGGGGG + Intronic
923357375 1:233172699-233172721 CAGGAGTACCTGGAGGAAGCAGG - Intronic
924646027 1:245878005-245878027 GAGTGTTCCCAGGAGGAGGAAGG + Intronic
1062768204 10:81049-81071 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1062901391 10:1149370-1149392 GTCGGGTGACTGGAGGAGGACGG + Intergenic
1063192032 10:3704550-3704572 CAGAGGTACCTTGAGGAAGAAGG + Intergenic
1063215453 10:3921608-3921630 GAGGGGTTAATGGACGAGGATGG - Intergenic
1063645501 10:7878450-7878472 GAGGGGTGACGGGAGGAGTAAGG + Intronic
1064493435 10:15884145-15884167 GTGGGATACCAGGAAGAGGAAGG + Intergenic
1065140699 10:22715348-22715370 TAGGTGTATCTGGAGGAAGACGG - Intergenic
1065297330 10:24289437-24289459 GAGGAGAAGGTGGAGGAGGAGGG + Intronic
1066005713 10:31144483-31144505 GACAGGGACTTGGAGGAGGATGG - Intergenic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1066235643 10:33481624-33481646 TAGGGGAGCCTGCAGGAGGAGGG + Intergenic
1067051768 10:43025527-43025549 CAGGGGCAGGTGGAGGAGGAGGG - Intergenic
1067077849 10:43198243-43198265 GAGGGGCATCTGGAGCAGGTCGG - Intronic
1067214821 10:44293139-44293161 GAGGGGGGCCTGGGGAAGGATGG + Intronic
1067343739 10:45423453-45423475 CAGGGCTTCCTGGAGGAGGCAGG - Intronic
1067559989 10:47298478-47298500 GAGGGGCACATGGAGAAGGAGGG + Intergenic
1068960051 10:62858598-62858620 GGGCGGTCCCTGGAGGAGGGTGG - Intronic
1069697015 10:70394030-70394052 GAGGGGTGCAATGAGGAGGAGGG - Intergenic
1069749542 10:70736492-70736514 GAGGGGTCCCTGGAGGCTGCCGG + Intronic
1070314238 10:75295225-75295247 GAGGGGTGGCAGGAGGAGGCAGG + Intergenic
1070648824 10:78220441-78220463 GAAGGCTTCCTGGAGGAAGAAGG + Intergenic
1070747230 10:78941479-78941501 GAGGGATACCTGAACTAGGAAGG + Intergenic
1071515038 10:86291557-86291579 GAGGGCTTCCTGGAGGTGGATGG - Intronic
1071821328 10:89284155-89284177 GAGGGGTTGCTGGAGGAGGAGGG + Intronic
1071877793 10:89861436-89861458 GAGGGGGAAGAGGAGGAGGAGGG - Intergenic
1071877808 10:89861482-89861504 GAGGGGGAGGAGGAGGAGGAAGG - Intergenic
1071937500 10:90547925-90547947 GAGGTGTACTTGGGGAAGGATGG - Intergenic
1072407475 10:95168605-95168627 GTGGGGGGCCTGGAGGAGCAGGG + Intergenic
1072451334 10:95541703-95541725 GAGGGGTACATAGGGGAGCAGGG - Intronic
1072889127 10:99306271-99306293 GAGGGTAAAATGGAGGAGGAGGG - Intergenic
1072996445 10:100249050-100249072 CAGGGGCAGCTGGAGGAGCATGG - Intronic
1073486045 10:103819819-103819841 GTGGGGTCCCTAGAGGAGGGGGG + Intronic
1073486183 10:103820510-103820532 GAGGGGGCACTGGGGGAGGAGGG - Intronic
1074575371 10:114663879-114663901 GTGGGGAACCTGGAGCAGGCAGG - Intronic
1075001877 10:118804757-118804779 GAAGGCTTCCTGGAGGAGGTGGG + Intergenic
1075733128 10:124648121-124648143 GAGGGTTTTCTGGAGGAGGCAGG - Intronic
1075847394 10:125555742-125555764 GTGGGGTACATGGCGGGGGAAGG + Intergenic
1076318900 10:129564261-129564283 GAGGGGGAAGAGGAGGAGGAAGG - Intronic
1076334878 10:129699758-129699780 GAGGTCTTCCTGGAGAAGGACGG - Intronic
1076634727 10:131874892-131874914 GAGGAGGAGCTCGAGGAGGAGGG + Intergenic
1076638571 10:131899440-131899462 GGGAGGTAAGTGGAGGAGGATGG - Intergenic
1076688417 10:132208543-132208565 GAGGGCCTCCTGGAGGAGGTGGG - Intronic
1077052073 11:571494-571516 CAGGGGTGGCTGGAGGAGGTGGG - Intergenic
1077177147 11:1196145-1196167 GGGGGGGACCTGGAGGAGGAGGG + Intronic
1077234870 11:1476084-1476106 GAGGCACACCTGGAGCAGGACGG + Intronic
1077297297 11:1832185-1832207 GAGGGTTCCCTGGAAGAGGTGGG + Intronic
1077355749 11:2115955-2115977 GAGCTGTACCTGGTAGAGGAAGG + Intergenic
1077358152 11:2128085-2128107 GGGAGTTGCCTGGAGGAGGAGGG - Intergenic
1077370042 11:2177530-2177552 GGGGACTGCCTGGAGGAGGAGGG - Intergenic
1077504449 11:2923643-2923665 GAGGGCTTCCTGGAGGAGGTTGG + Intronic
1077700253 11:4434790-4434812 GAGAGCTATCTGGAGGAGGCTGG - Intergenic
1077712741 11:4552656-4552678 GACGTGGACCTGGAGGAGCAGGG - Intergenic
1079107428 11:17580430-17580452 GAGGGGTCCCTGGAGTGAGAAGG + Intronic
1080255102 11:30281947-30281969 TAGAGGTACTTGGAGGAAGATGG - Intergenic
1080405155 11:31972048-31972070 GAGGGGGAGCGGGAGGGGGAGGG + Intronic
1080514315 11:33006014-33006036 GAGGGGTAGCTGTGGGAGGTGGG + Intergenic
1080604724 11:33855513-33855535 GGGGGCTACCTGGAAGAGGCGGG + Intergenic
1081330293 11:41792763-41792785 AAGGGGGACCTGGAGGAACAGGG - Intergenic
1081416774 11:42824698-42824720 GAGGGATACAGGGAGGAGAAGGG - Intergenic
1081680463 11:44998972-44998994 GAGGGGTGCGCGGGGGAGGAAGG - Intergenic
1081801876 11:45865674-45865696 GAGGGGCAGCAGGAGGCGGAGGG + Intronic
1083190511 11:61048617-61048639 GAAGGCTTCCTGGAGGAGGCAGG - Intergenic
1083664067 11:64265235-64265257 GCGGGGTACCTGGAGGCAGGGGG + Intronic
1083664608 11:64267704-64267726 GAGGGGCCCCAGGAGGATGAAGG - Intronic
1083674416 11:64317440-64317462 GGCGGGTACCTGGAGGCGCAGGG + Exonic
1083853367 11:65380251-65380273 GAGGGGTTCAGGCAGGAGGAAGG + Intronic
1084090365 11:66875577-66875599 GGGGGATGCCTGGAGGAGGGAGG + Intronic
1084531310 11:69729465-69729487 CTGGGGTCCCTGGTGGAGGAGGG - Intergenic
1084569581 11:69951378-69951400 GGGGGATACCTGGAGGGGGTGGG + Intergenic
1084680788 11:70665063-70665085 GAGGGGTCCCTGTAGGAGGAAGG - Intronic
1084891284 11:72238273-72238295 GAGGAGGACTTGGAGGAGGCTGG + Exonic
1084962726 11:72725827-72725849 GAAGGCTTCTTGGAGGAGGAAGG - Intronic
1085034492 11:73291970-73291992 GAGGGCGACCTGGAGGAGGTGGG - Intronic
1085249978 11:75136672-75136694 GAAGGCTCCCTGGAGGAGGTCGG - Intronic
1085470875 11:76756958-76756980 GAGGGGTCACTGGAGGAACAGGG - Intergenic
1085661407 11:78370747-78370769 AAGGGGTAAATGGAGGAGAAAGG + Intronic
1085794722 11:79528559-79528581 GAGTGGAAGCTGGTGGAGGAAGG - Intergenic
1085802480 11:79603235-79603257 GAAGGCTTCCTGGAGGAGGAGGG - Intergenic
1087494942 11:98879625-98879647 GAGGGGTCCCTTGTTGAGGATGG - Intergenic
1088251028 11:107860903-107860925 GAAGGGTTCCTGCAGTAGGAGGG - Intronic
1088256932 11:107911771-107911793 GAGGGGGAGGGGGAGGAGGAGGG - Intronic
1089122355 11:116146274-116146296 GGGGTGGACCTGGAGGAGCAGGG - Intergenic
1089178621 11:116565783-116565805 GGGAGGTACCAGGAGGAGCATGG - Intergenic
1089638308 11:119830943-119830965 GAGGGTGACATGGAGGAAGAAGG - Intergenic
1089757388 11:120696648-120696670 AAGGGGGACCTGGAGGAAGCTGG + Intronic
1090854270 11:130598355-130598377 GAGGGGTGGTTGGACGAGGAGGG + Intergenic
1091111616 11:132974232-132974254 GAGAGGTAGCTGGAAGATGAAGG - Intronic
1091237639 11:134032745-134032767 GGGCGGAGCCTGGAGGAGGATGG - Intergenic
1091301499 11:134510764-134510786 CAGGGGCAGCTGGAGGAGCAGGG - Intergenic
1091603089 12:1929800-1929822 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1091603174 12:1930052-1930074 GAGGGGGAGAAGGAGGAGGAGGG + Intergenic
1091765316 12:3116565-3116587 GAGAGGCCCTTGGAGGAGGAAGG + Intronic
1091966020 12:4742634-4742656 GGAGGGTTCCTGGAGGAGGCAGG + Intronic
1092077188 12:5683805-5683827 GAGGGCTTCCTGGAGGAGGCAGG + Intronic
1092226908 12:6753462-6753484 AAGGGGAAACTGGAGGACGAGGG + Exonic
1092892104 12:12978673-12978695 GAGAGGTACCTGTATGTGGAGGG + Intronic
1093057023 12:14566157-14566179 CAGAGGTACCTGGGGGAGGCTGG - Intronic
1093573068 12:20691238-20691260 GAGGGGGAGATGGAGGAGAAAGG + Intergenic
1093843296 12:23933216-23933238 CAGGGTTAGCTGGAGCAGGATGG - Intronic
1095244819 12:39907688-39907710 GAGGGCTTTCTGCAGGAGGATGG - Intronic
1095752778 12:45729627-45729649 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1095981166 12:47975560-47975582 CAGGGGGACCTGGAGGACCAGGG + Exonic
1096110921 12:49028797-49028819 TAGGGGTACCTCGAGGCTGAGGG - Intronic
1096181976 12:49556075-49556097 GAAGGCTTCCTGGAGGAGGCAGG - Intronic
1096255328 12:50058737-50058759 GAGGGGATCCTGGGGGAGGAGGG - Exonic
1096532057 12:52248493-52248515 GAGGGGCAGCTGGGGCAGGAGGG + Intronic
1096550596 12:52369502-52369524 GAGGGATTCCTGGAGAAGGGTGG + Intergenic
1096591044 12:52659432-52659454 GAAGGGTAAATGGAGGAGGTGGG + Intergenic
1096865705 12:54561470-54561492 TACTGGGACCTGGAGGAGGAAGG + Intronic
1097102902 12:56601868-56601890 AAGGGGTTCCTGGAGCAAGAAGG - Exonic
1097281906 12:57850188-57850210 GAGGGGTAAATGAGGGAGGAGGG + Intergenic
1097493341 12:60297186-60297208 GAGGGCAACCTGGAGGAGGCTGG - Intergenic
1098010758 12:66048707-66048729 GAGGTGTACCGGGCGAAGGAAGG + Intergenic
1098047181 12:66412005-66412027 TTGGGGTACCTGAAGGAGAAGGG + Intronic
1098190663 12:67945167-67945189 GAAGGCTTCCTGGAGGAGGAGGG + Intergenic
1098507637 12:71272529-71272551 GAAAGCTTCCTGGAGGAGGATGG - Intronic
1099300770 12:80891779-80891801 GAGGTGTAAGTGGAGAAGGAGGG + Intronic
1099436970 12:82657207-82657229 GAGGGCGACCTGGAGCAGGCTGG + Intergenic
1099438071 12:82667216-82667238 GACTGGGACCTTGAGGAGGATGG + Intergenic
1100173789 12:92006996-92007018 GAAGGCTCCCTGGAGGAAGAAGG + Intronic
1100565723 12:95791238-95791260 AGGGGGTGGCTGGAGGAGGAGGG - Intergenic
1101159600 12:101959943-101959965 GAGAGGTACATGGAGAAGCATGG - Intronic
1101849453 12:108390673-108390695 GCAGGCTTCCTGGAGGAGGAGGG + Intergenic
1101943390 12:109117553-109117575 AGTGGCTACCTGGAGGAGGAGGG - Intronic
1102240509 12:111321875-111321897 GAAGGCTTCCTGGAGGAGGGGGG + Intronic
1102488393 12:113273588-113273610 CAGGGGTTCCGGGAGTAGGAGGG - Exonic
1102793954 12:115672600-115672622 GAGAGGGAGATGGAGGAGGAAGG - Intergenic
1103555785 12:121765774-121765796 GAGGAGGAGCTGGAGGAGGGCGG - Intronic
1104608331 12:130206011-130206033 GTGGTGTCCCTGGAGGCGGACGG + Intergenic
1104657999 12:130588166-130588188 AAGGGCTTCCTGGAGGAGGCAGG - Intronic
1104707436 12:130958061-130958083 GAGGGGAACAGTGAGGAGGAAGG - Intronic
1104858350 12:131912379-131912401 TAGGGGTACATGGCGGGGGAGGG - Intronic
1105442875 13:20429992-20430014 GAGGAGTTCGGGGAGGAGGAGGG - Intronic
1105756839 13:23473536-23473558 GTGGGGCACCTGGATGTGGACGG - Intergenic
1106121019 13:26860160-26860182 GGGGGGCACCGGGAGAAGGATGG - Intergenic
1106158817 13:27182820-27182842 TCTGGGGACCTGGAGGAGGAAGG - Intergenic
1106346420 13:28883664-28883686 AAGGGGTAGCAGGAGGAGGCAGG + Intronic
1106679960 13:31999451-31999473 GAGGGGGAGGGGGAGGAGGAGGG - Intergenic
1106933276 13:34690293-34690315 GAGGGGCAGCAGGAGGAGAAGGG - Intergenic
1107115676 13:36742961-36742983 GAGGCCGACCTGGGGGAGGAAGG + Intergenic
1107688416 13:42927443-42927465 GAGGGCTAGCAGGAGGAGGGAGG - Intronic
1109946310 13:69436545-69436567 GTGGGGTACGGGGAGGGGGAGGG + Intergenic
1110425467 13:75362017-75362039 CAGGTGTACCTGGAAGAGCATGG + Exonic
1111292500 13:86187056-86187078 TGGGTGTACCTGGAGGAGCAGGG - Intergenic
1111678543 13:91416124-91416146 GAGAAGTACCTTGAGGAGGGAGG + Intronic
1112011746 13:95299361-95299383 GAGGGGCACGTGGAGGAGGAAGG - Intronic
1112229988 13:97580313-97580335 GAAGGGAAGCTGGAGAAGGAAGG - Intergenic
1113091280 13:106619398-106619420 AAGGGATCCCGGGAGGAGGAAGG - Intergenic
1113300073 13:109009852-109009874 GAGGGCTTTCTGGAGGAAGAGGG - Intronic
1113843229 13:113371761-113371783 GAGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1113932909 13:113977701-113977723 GGGGGGTACAGGGAGGAGGGTGG - Intergenic
1113966295 13:114155536-114155558 GGGTGTTACCTGGAGGGGGAAGG + Intergenic
1114215290 14:20653591-20653613 GAAGGGTTGCTGGAGGAGAAAGG + Intergenic
1114318050 14:21525226-21525248 GAGGGGGTGGTGGAGGAGGAGGG + Exonic
1115180653 14:30622194-30622216 GAGGTCTTCCTGGAGGAGGTGGG + Exonic
1115336051 14:32245209-32245231 GAGGGCCTCCTGGAGTAGGATGG + Intergenic
1115957156 14:38794158-38794180 GTGGGGGAACTGGAGGAGGCTGG - Intergenic
1116458041 14:45141521-45141543 GAAGGGAACAGGGAGGAGGAAGG - Intronic
1117084570 14:52186109-52186131 GAGGGGAAAGTGGAGAAGGAGGG - Intergenic
1117315395 14:54567038-54567060 GAGGAGTAAGAGGAGGAGGAAGG + Intergenic
1118394082 14:65321006-65321028 GAGGAGGAGCGGGAGGAGGATGG + Intergenic
1119323875 14:73747097-73747119 GAGGGCCAGCTGGAGGAGGTAGG - Intronic
1119707335 14:76791288-76791310 GAAGGTTACCTGGAGAAGGCAGG + Exonic
1121221476 14:92288601-92288623 GATGGAGGCCTGGAGGAGGAGGG - Intergenic
1121634826 14:95446793-95446815 GAAGGCTTCCTGGAGGAGGTAGG - Intronic
1121835545 14:97088867-97088889 GAGGATGACCTGGAGGAGGAAGG + Intergenic
1121862874 14:97336043-97336065 GAGGGGACCCTGGAAGAGGTGGG + Intergenic
1121866418 14:97366620-97366642 GAAGACTTCCTGGAGGAGGAGGG - Intergenic
1122082427 14:99274745-99274767 GAGGGGGAGAAGGAGGAGGAGGG - Intergenic
1122154747 14:99743297-99743319 GAAGGGTCCCTGGAGGAGGCAGG - Intronic
1122782624 14:104150110-104150132 GAGGGGGACCAGGAGGGGGAGGG - Intronic
1122931020 14:104933153-104933175 GAGGGCTCCCTGGAGGAGGTGGG - Exonic
1122985530 14:105209910-105209932 GAGGGGGGTCTGGAGGAGGCAGG + Exonic
1123023535 14:105413045-105413067 GAAGGCTTCCTGAAGGAGGAGGG - Exonic
1125393289 15:39219171-39219193 GAAGGGTAGCTGGGGGAAGAGGG + Intergenic
1125612333 15:40980014-40980036 CTGGGGTGCCTGTAGGAGGAAGG - Exonic
1125929409 15:43589835-43589857 GAGGGGGTCCTGTGGGAGGATGG - Intronic
1125942576 15:43689667-43689689 GAGGGGGTCCTGTGGGAGGATGG - Intergenic
1126780043 15:52131991-52132013 GAGGGATAGCGGGAGGAGGTGGG - Intronic
1127178726 15:56391340-56391362 GAAGGGCAACTGGAGGAAGAAGG + Exonic
1127642508 15:60929265-60929287 GAGGGAGGGCTGGAGGAGGAGGG - Intronic
1127905725 15:63374351-63374373 GAAGGCCTCCTGGAGGAGGAGGG - Intronic
1128214650 15:65925827-65925849 GAAGGCTTCCTGGAGAAGGAGGG - Intronic
1128313377 15:66645372-66645394 GAAGGCTGCCTGGAGGAGGTGGG - Intronic
1128327024 15:66730342-66730364 GAAGGCTTCCTGGAGAAGGAAGG - Intronic
1128513611 15:68328254-68328276 GGGCGGGACCTGGAGGAGAAGGG + Exonic
1128729913 15:70014128-70014150 GAGGCCTTCCTGGAGGAGGACGG - Intergenic
1128783360 15:70377421-70377443 GAGGGGAGGTTGGAGGAGGAAGG - Intergenic
1128804649 15:70521765-70521787 TAGGGGTACCGGGAGCAGGTAGG + Intergenic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1128895786 15:71372651-71372673 GAGGGGTACCTGGCCGTGTAAGG + Intronic
1128898574 15:71398356-71398378 GAGGGTGACCTGAAGAAGGAAGG + Intronic
1129168829 15:73795643-73795665 GAGGGCTTCCTGGAGGAGGAAGG + Intergenic
1129168920 15:73796146-73796168 GAGCGCTTCCTGGAGGAGGAAGG - Intergenic
1129234888 15:74218113-74218135 GCAGGCTGCCTGGAGGAGGAGGG + Intergenic
1129253157 15:74319624-74319646 GGGGTCTTCCTGGAGGAGGAGGG + Intronic
1129269958 15:74414358-74414380 GAGAGCTTCCTGGAGGAGGTAGG - Intronic
1129524747 15:76206614-76206636 AAGGTGAGCCTGGAGGAGGAGGG - Intronic
1129692982 15:77724176-77724198 TGGGGGTACCTGGAGGAAGCGGG - Intronic
1129871327 15:78943838-78943860 GAGGGCTGCCTGGAGAAGGCTGG - Intronic
1130542780 15:84833838-84833860 GAGGGGTCCCTGGGGGAGACAGG - Intronic
1130810392 15:87371019-87371041 TATGGGGACTTGGAGGAGGAAGG - Intergenic
1130959901 15:88652557-88652579 GAGGGGGAGGGGGAGGAGGAAGG - Intronic
1131054689 15:89368388-89368410 GAGGGGTCGCTGGAAGGGGAAGG + Intergenic
1131392820 15:92062887-92062909 GAGAGGGACCTGCAGGAGGCGGG - Intronic
1131423363 15:92326034-92326056 CAGTGGTACCTGGAGAAGGGAGG + Intergenic
1132092996 15:98960783-98960805 GAGGGCAGCCTGGAGGGGGAGGG - Exonic
1132185447 15:99798792-99798814 GAGGGGACCCTGGGGGAGGTAGG + Intergenic
1132240450 15:100253481-100253503 GAGGGGAACGTAGAGGGGGAGGG + Intronic
1132457104 16:30025-30047 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1132478747 16:155185-155207 GAGGGGTGCCCAGTGGAGGAGGG - Intronic
1132599624 16:767866-767888 GAGGGGCGCGTGGAGGAGGAGGG + Intronic
1132599674 16:767987-768009 GGGGGGCGCGTGGAGGAGGAGGG + Intronic
1132656608 16:1044241-1044263 CAGGGGTCCCAGGAGGAGGGCGG - Intergenic
1132762924 16:1519717-1519739 GAGGGCTCCCAGGAGGAGGTGGG + Intronic
1132934390 16:2473559-2473581 AAGGGGAAGCTGGCGGAGGAGGG - Intronic
1133112097 16:3554178-3554200 GAGAGGCCCTTGGAGGAGGAGGG + Intronic
1133272829 16:4619037-4619059 GAGTGGTACCTGGACGATGGTGG - Intronic
1133392625 16:5422328-5422350 GAGGAGAACGTGGAGGAGGAGGG + Intergenic
1133520157 16:6549194-6549216 GAGGGGAAAAGGGAGGAGGAGGG + Intronic
1133732816 16:8590669-8590691 GAAGGGTACTTGGAGCTGGAGGG - Intergenic
1134102241 16:11460638-11460660 GAGGGCTGCCTGGCAGAGGAGGG - Intronic
1135485762 16:22863346-22863368 GAGGGCATCCTGGAGGAAGAGGG - Intronic
1135927417 16:26707848-26707870 GAGTGGTCCCTGGGTGAGGATGG + Intergenic
1136156813 16:28388620-28388642 CAGCGCTACCTGGAGGAGAAGGG - Exonic
1136206273 16:28726661-28726683 CAGCGCTACCTGGAGGAGAAGGG + Exonic
1136510850 16:30737540-30737562 GAGGGGTACAGGCAGGAGGAGGG - Exonic
1136568088 16:31081713-31081735 GAAGGGTCCCAGGAGGAGGTGGG + Intronic
1136585260 16:31180362-31180384 GAAGAGTAACTGGAGGAGGCTGG + Intronic
1137257526 16:46789453-46789475 GAGGGGGAGGGGGAGGAGGAGGG - Intronic
1137724984 16:50650993-50651015 GAGGGCTTCCTGGAGGAGCGGGG - Intergenic
1137727517 16:50667133-50667155 GAGTGGTAACTGGAGGCGGGCGG + Intronic
1138416882 16:56876674-56876696 GGGGGCTACCAGGAGGAGGTGGG - Intronic
1138594083 16:58020256-58020278 CAGAGGGCCCTGGAGGAGGAAGG - Exonic
1138969574 16:62128685-62128707 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1139165756 16:64563332-64563354 GAGGAGGAGGTGGAGGAGGAGGG + Intergenic
1139361084 16:66400694-66400716 GAGGGCTTCCTGGAGGAGCCAGG + Intronic
1139532273 16:67548199-67548221 CAGGGGTCCCTGGAGGAGGCCGG + Intergenic
1140172941 16:72626045-72626067 GAGGGGTACGGGGAGAGGGAGGG + Intergenic
1140655197 16:77132485-77132507 GAGGAGGACGAGGAGGAGGAGGG - Intergenic
1141372444 16:83500487-83500509 GAGGGGGAGGGGGAGGAGGAGGG - Intronic
1141428819 16:83960526-83960548 GAGGGGCTGCTGGAGGAGGGCGG - Intronic
1141633836 16:85303428-85303450 GAGGGCTTCCTGCAGGAGGAGGG - Intergenic
1141656305 16:85418481-85418503 GAGGGCTTCCTGGAGGAGGCGGG - Intergenic
1141690559 16:85594100-85594122 GAAAGGGGCCTGGAGGAGGAGGG + Intergenic
1141766870 16:86064610-86064632 GAGGGAAACCTGAAGGAGGGGGG - Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1141993484 16:87622994-87623016 GAGGGGGACCTGGTGGAGGTCGG + Intronic
1141999980 16:87658752-87658774 GAGGGGTGGCTGGAGGAGAGAGG - Intronic
1142137833 16:88459749-88459771 GAGGGGGAGAGGGAGGAGGAAGG - Intronic
1142170980 16:88622661-88622683 GAGGGGCACCTGGATGCGGGAGG + Intronic
1142265163 16:89061097-89061119 GAGGGGGATTTGCAGGAGGAGGG - Intergenic
1142362237 16:89632941-89632963 GAGGGGCTGCAGGAGGAGGAGGG + Intronic
1142420124 16:89964784-89964806 GAGCGGCACCTGGGGGATGAGGG + Intronic
1142674274 17:1503926-1503948 GAGAGGAACCTGGAGGGGGCCGG - Intronic
1142955842 17:3521211-3521233 GAAGGCTTCCTGGAGGAGGCAGG - Intronic
1143014840 17:3886213-3886235 GAGGGCTCCCTGGAGGAGGCGGG - Intronic
1143383097 17:6508530-6508552 TAGTGCTTCCTGGAGGAGGAAGG + Intronic
1143561802 17:7700908-7700930 CAGGGGTCTTTGGAGGAGGAAGG + Intronic
1144194008 17:12873326-12873348 AAAGGCTTCCTGGAGGAGGAGGG - Intronic
1144269516 17:13602336-13602358 GCGGGGAACCTGGAGAGGGAGGG - Intergenic
1144415462 17:15042319-15042341 CAGGGGTTCCTGGAGGATCATGG - Intergenic
1144678465 17:17176837-17176859 CAGGAGTCCCTGGAGGAGGCTGG - Intronic
1144771075 17:17759970-17759992 GAGGGCTTCCTGGAGGAGATGGG + Intronic
1144777814 17:17793597-17793619 GAGGAGTAGGTGGAGGAGGTGGG - Exonic
1145056414 17:19706630-19706652 CATGGGTACGTGGAAGAGGATGG - Exonic
1145251767 17:21300684-21300706 GAGGGCTCCCTGGAGGAGGCGGG + Intronic
1146185195 17:30720071-30720093 GAGGGCTTCCTGGAGGAGGTGGG + Intergenic
1146585807 17:34080577-34080599 GAGAGGTACCTGCAGAGGGAAGG + Intronic
1146610619 17:34301926-34301948 TAGGGCTACATGGAGGAGGGAGG + Intergenic
1146839597 17:36141394-36141416 GAGGGTGGCCTGGAGGAGTAGGG + Intergenic
1147228586 17:39000760-39000782 GAGGGGGTCCTGTGGGAGGATGG - Intergenic
1147255192 17:39177174-39177196 GCAGGGAACATGGAGGAGGAAGG - Intronic
1147267587 17:39244268-39244290 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1147323407 17:39659142-39659164 AATGGGTGCCTGGAGGAGGGCGG + Intronic
1147363018 17:39943318-39943340 GAGGAGGACGGGGAGGAGGAGGG + Intronic
1147498777 17:40942374-40942396 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1147962367 17:44175856-44175878 TAGGGGAAAGTGGAGGAGGATGG + Intronic
1147978413 17:44260709-44260731 GAGGAGAACCTGGGGGAGAATGG - Exonic
1148028289 17:44603215-44603237 GAGGGGGATCTGGATGAGGCTGG + Intergenic
1148071845 17:44913225-44913247 AAGGGCTGCCTGGAGGAGGCAGG + Intronic
1148155553 17:45423490-45423512 GAGTGCTTCCTGGAGGAGGAAGG - Intronic
1148467853 17:47875463-47875485 GATGGAGACCTGGAGGAGGGAGG - Intergenic
1148611976 17:48970651-48970673 GAGAGGTACCTGGACTAGCAGGG + Intergenic
1149107099 17:52982639-52982661 GAGGGGGAGGGGGAGGAGGAGGG - Intergenic
1149195171 17:54110792-54110814 GAGGGGGAGGTGGAGGGGGAGGG + Intergenic
1149504535 17:57183101-57183123 GAAAGGGAACTGGAGGAGGAGGG + Intergenic
1150358400 17:64507157-64507179 GAGGCCTCCCTGGAGGTGGACGG - Intronic
1150387240 17:64772147-64772169 GAGTGCTTCCTGGAGGAGGAAGG - Intergenic
1151362807 17:73598708-73598730 GGGTGGTCCCTGGAGGGGGATGG - Intronic
1151401366 17:73857996-73858018 GAGGGGGCCCTGAGGGAGGAGGG - Intergenic
1151436757 17:74102498-74102520 GAGGAGTGTGTGGAGGAGGAAGG - Intergenic
1151448346 17:74181854-74181876 GAGGGAAGCCTGCAGGAGGAGGG - Intergenic
1151518853 17:74614356-74614378 GTGGAGTTCCAGGAGGAGGAGGG + Intronic
1151943520 17:77306975-77306997 CAGGGTTACCTGGGGGAGTAGGG + Intronic
1152185834 17:78855870-78855892 GAGGGGCACACGGAGGGGGACGG + Intronic
1152368320 17:79870220-79870242 GAGGGGAAGTGGGAGGAGGAAGG - Intergenic
1152603023 17:81274602-81274624 GAGGGGAACCTGGACGGGGCAGG + Intronic
1152645436 17:81466531-81466553 GTGGGGTCCCTCCAGGAGGAGGG + Intergenic
1152790567 17:82276605-82276627 GAGAGGGAGCTGGAGGAGTAGGG + Intergenic
1152961093 18:80546-80568 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1153939662 18:9967391-9967413 CAGGGGTACCTGTAACAGGAAGG - Intergenic
1155285510 18:24284880-24284902 GAAGGCTTCCTGGGGGAGGATGG - Intronic
1155570202 18:27184849-27184871 GAGGGGGCGCTGGAGAAGGACGG - Intronic
1156460073 18:37316658-37316680 AAGGGCTTCCTGGAGGAGGTGGG - Intronic
1156882395 18:42096128-42096150 GAGGGGTAAAGGGAGCAGGAGGG + Intergenic
1157158245 18:45288473-45288495 CAGGGGTACCTGTAGGGGAAGGG - Intronic
1157294790 18:46434810-46434832 GAGGCCTTCCTGGAGGAGGAAGG + Intronic
1157477792 18:48034519-48034541 GAGGAGTGCTGGGAGGAGGAGGG - Intronic
1157555598 18:48611018-48611040 CAGGGGTCCCTGGAGAAGGCAGG + Intronic
1157618764 18:49003325-49003347 GAGGGGAAAAGGGAGGAGGATGG - Intergenic
1157935477 18:51867398-51867420 TAGGGATACGTGGAAGAGGAGGG - Intergenic
1158646731 18:59254964-59254986 GAGGGGGAGCGGGAGGCGGAGGG - Intergenic
1159984759 18:74828926-74828948 GAGGGGGAGGTAGAGGAGGACGG - Intronic
1160710299 19:548359-548381 GAGGGCTTCCTGGAGGAGGTGGG + Intronic
1160819718 19:1052362-1052384 GAGGGGGAAGAGGAGGAGGAGGG + Intronic
1160889736 19:1370938-1370960 GAGACCTACCTGGAGGATGAGGG + Exonic
1160900244 19:1424338-1424360 GAGGGGGAGGGGGAGGAGGAGGG - Intronic
1160940545 19:1618628-1618650 GGCAAGTACCTGGAGGAGGAGGG - Intronic
1161085440 19:2332963-2332985 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161085461 19:2333024-2333046 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161085499 19:2333145-2333167 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161281442 19:3447817-3447839 AGGGGGTGCCTGGAGGGGGAGGG + Intronic
1161348299 19:3778651-3778673 GAGGGCTTCCTGGAGGAAGCAGG - Intronic
1161428688 19:4218104-4218126 GAGGGGCAGCTGGAGGAGCTGGG + Exonic
1161606723 19:5219248-5219270 GAGGGCTTCCTGGAAAAGGAGGG - Intronic
1161630401 19:5352098-5352120 GAGGGCTTCCTGGAGGTGGCAGG - Intergenic
1161701064 19:5795605-5795627 GAAGGCTTCCTGTAGGAGGAGGG + Intergenic
1161713974 19:5865250-5865272 AAGGGGAACCTGGTGGTGGAAGG - Intergenic
1161821508 19:6533478-6533500 AAGGGGTTTCTGGAGGGGGAGGG - Intronic
1161821543 19:6533558-6533580 AAGGGGTCTCTGGAGGGGGAAGG - Intronic
1162038146 19:7953485-7953507 GAGGGGGAGGGGGAGGAGGAGGG - Intergenic
1162562287 19:11423700-11423722 GAACGGTAGCTGGAGGGGGAAGG + Intronic
1162805495 19:13136048-13136070 GAGGAGGACGAGGAGGAGGATGG + Exonic
1162925707 19:13929792-13929814 GATGGGCACCTGGAGGGGGAGGG + Intronic
1162925721 19:13929822-13929844 GATGGGCACCTGGAGGGGGAGGG + Intronic
1162925746 19:13929882-13929904 GATGGGCACCTGGAGGGGGAGGG + Intronic
1162925760 19:13929912-13929934 GATGGGCACCTGGAGGGGGAGGG + Intronic
1162925774 19:13929942-13929964 GATGGGCACCTGGAGGGGGAGGG + Intronic
1162925787 19:13929972-13929994 GATGGGCACCTGGCGGGGGACGG + Intronic
1162973585 19:14195618-14195640 GAGGGCTTCCTGAAGGAGGCGGG - Intronic
1163197419 19:15732807-15732829 GAGGTGGACCAAGAGGAGGAGGG + Intergenic
1163198682 19:15746053-15746075 GAGGAGGACGTGGAGGAGGAAGG - Intergenic
1163234715 19:16023666-16023688 GAGGGGTCCCTGGGAGAGGTTGG - Intergenic
1163538915 19:17894877-17894899 GAGGTATTACTGGAGGAGGATGG + Exonic
1163609320 19:18292830-18292852 GAGGGGAAGCTGAAGCAGGAAGG - Intergenic
1163723802 19:18911162-18911184 GAGGGGTCCCTGGTGGGGCAGGG - Intronic
1163862269 19:19748603-19748625 GAGGGGTTCCTGGAAGGGGTTGG - Intergenic
1164474857 19:28568004-28568026 GTGGGCTTCCTGGAAGAGGAAGG + Intergenic
1164669249 19:30063465-30063487 GAAGGCTGCCTGGAGGAGGGTGG - Intergenic
1164683175 19:30149531-30149553 GAAGGCTTCCTGGAGGGGGAGGG + Intergenic
1164918420 19:32070373-32070395 GAGGGGTCCCTGGAGAGGGTAGG - Intergenic
1165149823 19:33753872-33753894 GAGGGGTAGTGGTAGGAGGATGG - Intronic
1165162634 19:33826747-33826769 CAGGGGTGCCTGGGGTAGGAGGG + Intergenic
1165273043 19:34726625-34726647 GAGGGGTACAAGGAGTAGGGCGG - Intergenic
1165820199 19:38670098-38670120 GAGGGGCATATGGAGGAGAAAGG - Intronic
1165830767 19:38729193-38729215 GAGGGGTCCCTGCAGTGGGAGGG + Intronic
1165947014 19:39449616-39449638 GATGGCTGCCTGGAGGAGGAAGG + Intronic
1166339771 19:42130771-42130793 GAGGGCTTCCTGGAGGAAGGGGG - Intronic
1166340572 19:42134489-42134511 GAGGGGATCTTGAAGGAGGATGG + Intronic
1166571584 19:43800074-43800096 GAGGGCTTCCTGGAAGAGGGTGG - Intronic
1166717034 19:44975153-44975175 GAGGGCTTCCTGGAGGAGGTTGG - Intronic
1166859954 19:45804367-45804389 GAGGGCGACGAGGAGGAGGAAGG - Exonic
1167042778 19:47032444-47032466 GGGGGGTACCTGGACTGGGAAGG + Intronic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167324896 19:48818392-48818414 GAGAGGTTCCCTGAGGAGGAGGG - Intronic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167446213 19:49539105-49539127 CAGGGTTTCCTGGAGGAGAAAGG - Exonic
1167499144 19:49835813-49835835 GAGGGGCACCTGGCGGGGGCTGG - Exonic
1167597646 19:50435865-50435887 GAGGGGAACCCGGGGGAGGAGGG + Intronic
1167648526 19:50718254-50718276 GCTGGGTACCTGGAGGGGGAGGG - Intronic
1167698388 19:51027891-51027913 GAAGGGAAACTGGAGGAGGGAGG - Intronic
1167776500 19:51561103-51561125 GAGGTCTCCCTGGAGGAGGAGGG + Intergenic
1168056069 19:53866111-53866133 GAGGGGGACCTGCAGGAAGGCGG - Intergenic
1168099990 19:54136280-54136302 GAGGTGAACGTGAAGGAGGATGG - Intergenic
1168255569 19:55162910-55162932 GCTGGGAAGCTGGAGGAGGAGGG - Intronic
924985266 2:264485-264507 GAGGGGTACCTGGAGGAGGAAGG - Intronic
925294664 2:2768999-2769021 GAAAGGGACCTGGAGGGGGAGGG - Intergenic
925333239 2:3074882-3074904 GAGGGACACCTGGAGGCTGAGGG - Intergenic
925376023 2:3386771-3386793 GAGGGCTTCATGGAAGAGGAGGG + Intronic
925693354 2:6548343-6548365 GAGGGGGACCTGGAAGAAGCTGG + Intergenic
926223383 2:10950929-10950951 AAGGGTTTCCTGGAAGAGGATGG - Intergenic
926506446 2:13721873-13721895 GATGGGGAGCTGGAGGGGGATGG - Intergenic
927177961 2:20423519-20423541 GAGGAGTAGGTGGAGCAGGATGG + Intergenic
927203996 2:20595494-20595516 GAGGGCTTCCTGGAGGAGGGAGG + Intronic
927471505 2:23380983-23381005 GATGCCTTCCTGGAGGAGGAAGG - Intergenic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
928194752 2:29207139-29207161 CAGGGATACCTGGAGGATGATGG + Intronic
928256245 2:29725408-29725430 GACAGGGACCTTGAGGAGGAGGG - Intronic
928363248 2:30682260-30682282 GTGGGCTACCTGGAGGAGGTAGG - Intergenic
929121128 2:38484857-38484879 GAGTGGTCCCTTCAGGAGGAAGG - Intergenic
929544301 2:42845765-42845787 GAGGGATCCAGGGAGGAGGAGGG + Intergenic
929871112 2:45760109-45760131 GAAGGTTACTTGGAGGAGGCAGG + Intronic
930013706 2:46956711-46956733 GAAGGCTTTCTGGAGGAGGAGGG + Intronic
930046498 2:47176980-47177002 GAAGGATACGTGGAAGAGGAAGG - Intergenic
930569781 2:53070709-53070731 GTGGGGTAGGGGGAGGAGGAAGG + Intergenic
930595421 2:53381645-53381667 CAGGGGTAGCTGTAGGAAGAAGG - Intergenic
931432104 2:62216360-62216382 GAGGGAGGCCTGGGGGAGGAGGG + Intronic
932192411 2:69752063-69752085 GAAGGCTTCCTGGAGGAGGAAGG + Intronic
932402223 2:71488958-71488980 GAGGAGCAGCTGAAGGAGGAAGG - Intronic
932409272 2:71535555-71535577 GAAGGCTTCCTGGAGGAGGTGGG + Intronic
933746857 2:85577940-85577962 TCGGGCTCCCTGGAGGAGGAAGG - Intronic
934540063 2:95166272-95166294 GAGGGCTTCATGGAGGAGGTGGG + Intronic
934572645 2:95382508-95382530 GAGGGGAGCCTGGCAGAGGAAGG + Intronic
935217856 2:100988812-100988834 CAGGGGGACCTGGAGGAGCAGGG - Intronic
935217910 2:100988960-100988982 CAGGGGGGCCTGGAGGAGCAGGG - Intronic
935946261 2:108289348-108289370 GAGCTGGCCCTGGAGGAGGATGG - Intronic
936487275 2:112936962-112936984 GAGGGGTACAGGGAGGAGGTGGG - Intergenic
937239280 2:120449989-120450011 GAGGGCTTCCTGAAGGAGGTGGG + Intergenic
937262584 2:120595916-120595938 GAGGGCTTCCTGGAAGAGGTGGG + Intergenic
937319965 2:120955282-120955304 GGGTGGTGCCTGGAGCAGGAAGG - Exonic
937354932 2:121192369-121192391 GAGGGCTTCCTGGAGAAGGTGGG - Intergenic
938102263 2:128505160-128505182 GGGGGGTGACTGGAGGGGGAAGG - Intergenic
938178942 2:129162513-129162535 GAGGGGCAGAAGGAGGAGGAAGG + Intergenic
938302697 2:130228285-130228307 GGGGGCTTCCCGGAGGAGGAAGG - Intergenic
938314970 2:130318985-130319007 GCGGGGGACCTGGAGGTGCAGGG - Intergenic
938348664 2:130583151-130583173 GGGGGGTTTCAGGAGGAGGATGG - Intronic
938684122 2:133720445-133720467 GAAGGCAACATGGAGGAGGAGGG - Intergenic
939045475 2:137245056-137245078 GAGGGAGACGAGGAGGAGGAGGG - Intronic
939983219 2:148805651-148805673 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
941488111 2:166106822-166106844 GAAGGGTCACTGCAGGAGGAAGG - Intronic
941916914 2:170818910-170818932 GAGGGCTTCGCGGAGGAGGAGGG + Intronic
942859355 2:180590981-180591003 GAGGGGTACCCGGATGTGTAAGG + Intergenic
943890257 2:193277272-193277294 GAGGGGGAGGAGGAGGAGGAAGG - Intergenic
945052997 2:205843254-205843276 GAGGGCAACCTGGAGGAGTTAGG - Intergenic
946380684 2:219346693-219346715 AAGGGGTGACTGGAGGAGGAAGG - Intergenic
947557715 2:231111273-231111295 GAGGGGTAGCAGGACAAGGAAGG - Intronic
948682456 2:239645065-239645087 GATGGGGCACTGGAGGAGGAGGG - Intergenic
948691283 2:239706691-239706713 GAGGGCACTCTGGAGGAGGAAGG + Intergenic
1168830983 20:845206-845228 GAGGGGTGGCTGGGGGAGGACGG - Exonic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1171178218 20:23070965-23070987 GAGGAGGAGGTGGAGGAGGAAGG + Intergenic
1171372057 20:24668574-24668596 GAGGGGTACCTGGGGAGGCAGGG - Intergenic
1171424831 20:25042860-25042882 GAGGGGTGTCTGGAGGATGAGGG - Intronic
1171971484 20:31567672-31567694 GTGGGGTAGCTGGAGCATGAGGG - Intronic
1171983754 20:31645114-31645136 GAGGGCTTCCTGGAGGAGTGGGG + Intergenic
1172031985 20:31988773-31988795 GAGGGCTTCCTGTAGGAAGAAGG + Intronic
1172042023 20:32052527-32052549 GAGGGGTCCCAGGAGGCGGAGGG + Intronic
1172389007 20:34553453-34553475 GAGGCCAACGTGGAGGAGGAGGG - Intronic
1172618361 20:36305066-36305088 GAGGGCTTCCTGGAAGAGGCAGG - Intergenic
1172773911 20:37396509-37396531 GAGGGGGACAGGGAGGAGGGGGG - Intronic
1173795746 20:45858037-45858059 GAGGGCTGCCTGGAGGAGGAGGG + Intronic
1173857466 20:46259650-46259672 GAGGGCTGCCTGGAGGAGGGGGG + Intronic
1173960890 20:47071797-47071819 GAGAGGAACATGCAGGAGGAGGG - Intronic
1174190235 20:48735263-48735285 GTGAGGTCACTGGAGGAGGAAGG + Intronic
1174372615 20:50102850-50102872 CTGGTGTAGCTGGAGGAGGATGG - Intronic
1174451883 20:50625687-50625709 GAGGGAGACCTGGCTGAGGAGGG + Intronic
1174725722 20:52859678-52859700 GAGGTCTTCCTGGAAGAGGAGGG - Intergenic
1175100624 20:56576247-56576269 GAGGAGTAGGAGGAGGAGGAGGG - Intergenic
1175183502 20:57164909-57164931 TAAGGGTACCTGGAGGAAGCAGG - Intergenic
1175249593 20:57601205-57601227 GAAGGCTTCCTGGAGGAGGAGGG - Intergenic
1175531123 20:59674754-59674776 GAGGGGGAACAGGAGAAGGAGGG - Intronic
1175690954 20:61065719-61065741 GCGGGGTTCCTGGGGAAGGATGG + Intergenic
1175841582 20:62031269-62031291 GTGCGGTGCCTGGAGGACGAGGG - Intronic
1175921078 20:62450916-62450938 GGAGGGGACCTGGGGGAGGAAGG - Intergenic
1177156927 21:17510317-17510339 GAGGAGGACCGGGAGGACGAAGG - Intergenic
1177758261 21:25373584-25373606 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1178454244 21:32732554-32732576 GAGGGGAGCCTGGAGGAGGCTGG - Intergenic
1178715417 21:34959917-34959939 GGGGGCTACCTGGATGAGGAGGG + Intronic
1179486219 21:41712365-41712387 GAGGGGGACCTGCAGGGGGAGGG + Intergenic
1179582429 21:42352114-42352136 GACGGGGGCCTGGAGGATGATGG - Intergenic
1179582481 21:42352264-42352286 GATGGGGGCCTGGAGGATGAGGG - Intergenic
1179597391 21:42452075-42452097 GAGGGCTTCCTGGAGGGGGTGGG - Intergenic
1180066264 21:45414060-45414082 GAGGAGGATCGGGAGGAGGAGGG + Intronic
1180104268 21:45607619-45607641 GAGGGGAAAATGGAGGAGAAAGG + Intergenic
1180129266 21:45816482-45816504 GAGGGGGAAGGGGAGGAGGAGGG - Intronic
1180141982 21:45898513-45898535 GAGGGGTCCGTGGAGGGAGAGGG - Intronic
1180600495 22:17012293-17012315 GAGGGCTTCTTGGAGGAGGAGGG + Intergenic
1180955163 22:19738221-19738243 AAGGGGAGACTGGAGGAGGAGGG - Intergenic
1181033818 22:20160515-20160537 GAGGGGTTCCTGGTGGAGTGTGG + Intergenic
1181435302 22:22906953-22906975 AAGGGGTGACTGGAAGAGGAAGG - Intergenic
1181674848 22:24444876-24444898 GAGGGGTGGTTAGAGGAGGAGGG - Intergenic
1181780420 22:25188813-25188835 GAGGGGGAGGTGGAAGAGGAGGG + Intronic
1181871608 22:25903561-25903583 GAGGTATCCCTGGGGGAGGAGGG + Intronic
1181953714 22:26573110-26573132 GAGCAGTCCCTGGAGGAAGAAGG - Intronic
1182931456 22:34178253-34178275 GAGGGGGATAAGGAGGAGGAAGG - Intergenic
1183160568 22:36110430-36110452 GTTGGGACCCTGGAGGAGGAAGG + Intergenic
1183322319 22:37172544-37172566 GAGGGGTCCCTGGAGAAGAGGGG + Intronic
1183390933 22:37545540-37545562 GAGGGCTTCCTGGAGGAAGGAGG - Intergenic
1183536104 22:38402314-38402336 GAAGGCTGCCTGGAGGAGGCAGG + Intergenic
1183600962 22:38840446-38840468 TGGGGCTGCCTGGAGGAGGATGG + Intronic
1183663704 22:39235516-39235538 GTGGGGTGCCAGGAGGAGGGAGG - Intronic
1183733621 22:39631542-39631564 GAGGACTGCCTGGAGGAGGAGGG + Intronic
1183857331 22:40644024-40644046 GAGGGCTTCCTGGAGGAAGTGGG - Intergenic
1184286750 22:43476329-43476351 GAAGGCTCCCTGGAGGAGGTGGG + Intronic
1184450490 22:44579677-44579699 CAGGGCTTCCTGGAGGAGGTGGG - Intergenic
1184663234 22:45975179-45975201 TAGGGGTGCCAGGAGGGGGAAGG + Intronic
1184684800 22:46091415-46091437 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1184684811 22:46091451-46091473 GAGGGCCTCCTGGAGGAAGAGGG - Intronic
1184684820 22:46091487-46091509 GAGGGCTTCCTGGAAGAAGAGGG - Intronic
1184684827 22:46091523-46091545 GAGGGCTTCTTGGAGGAAGAGGG - Intronic
1184684836 22:46091559-46091581 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1184684845 22:46091595-46091617 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1184863873 22:47191999-47192021 GAGGGATAGATGGAGGAGGCAGG + Intergenic
1184951186 22:47843646-47843668 GAGGCACCCCTGGAGGAGGACGG + Intergenic
1185005924 22:48277012-48277034 GATGGGGCCCTGGAGGAGGATGG - Intergenic
1185128803 22:49025913-49025935 GGGGGGTACCTGGGGCAGGTGGG + Intergenic
949495713 3:4629806-4629828 GAGGGCTTCCTGGAGGAAGAAGG + Intronic
949944215 3:9177446-9177468 CTGGGGGACCTGGAGGAGGCAGG + Intronic
950387419 3:12671079-12671101 GAGGGGCACCAAGAGGAGGGAGG + Intergenic
950649157 3:14396469-14396491 GAGGGGAGCCTGGAGTTGGAGGG + Intergenic
951104360 3:18725736-18725758 GAGGGGGATGTGGAGGCGGAGGG + Intergenic
952164409 3:30731227-30731249 CCTGGGTACCTGGAGGACGAAGG - Intronic
952322300 3:32289447-32289469 GAAGGCTTCCTGGAGGAGGTGGG + Intronic
952877394 3:37957772-37957794 GAGGGGTGGCTGGTGCAGGACGG - Intronic
952877839 3:37961999-37962021 GGGGGGTGGGTGGAGGAGGAAGG - Intronic
953365420 3:42340458-42340480 GAGGGGGAGGAGGAGGAGGAGGG + Intergenic
953798327 3:46002346-46002368 GAGGGCAACCTGGAGGGGGCTGG - Intergenic
953925167 3:46979108-46979130 GAAGGCTTCCTGGAGGAGGGAGG + Intronic
954047707 3:47947303-47947325 GCTGGGTGCCAGGAGGAGGAAGG - Intronic
954072190 3:48151073-48151095 GAGGAGTCCTTGGGGGAGGATGG + Intergenic
954100397 3:48367935-48367957 AAGGGGTCCCTGCAGGGGGAAGG - Intergenic
954156419 3:48687336-48687358 GAGGGCTTCTGGGAGGAGGAAGG - Intergenic
954388664 3:50257799-50257821 GGGGTGAACCTGGAGGGGGAGGG + Intronic
954412014 3:50374920-50374942 GAGGGGTCCCTGGTGGTGGGAGG - Intronic
954413638 3:50382240-50382262 TGGGGGTCCCTGAAGGAGGAAGG - Intronic
954608187 3:51929753-51929775 GAAGGGTAGCTGGTGCAGGACGG - Intergenic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
955950192 3:64235961-64235983 CAGGGGTACCTGGAGAAGAGAGG + Intronic
956901096 3:73716967-73716989 GAATGGTACATGGAGAAGGAAGG - Intergenic
960454939 3:117859576-117859598 GAGAGGTGACTGAAGGAGGAAGG - Intergenic
961102455 3:124211903-124211925 GAAGGCTTCCTGGAGGAAGAGGG + Intronic
961111236 3:124285028-124285050 TAGGGGTAGCAGGAGAAGGAGGG + Intronic
961168722 3:124780778-124780800 GAGGGGAAGAGGGAGGAGGAGGG - Intronic
961665530 3:128491456-128491478 GAGGGGTACGGGGAGGAAGTGGG + Intronic
961820213 3:129572032-129572054 GAAGGCTTCCTGGAGGAGGTGGG - Intronic
961936589 3:130591065-130591087 GAAGGCTACCTGGGAGAGGAGGG + Exonic
963094400 3:141520375-141520397 GTGGTGTACCTGCTGGAGGAGGG + Intronic
964474418 3:157085677-157085699 GTGGGGTTACTGGAGCAGGAGGG + Intergenic
966350807 3:179031959-179031981 GAGGGGGAGGGGGAGGAGGAGGG - Intronic
966350823 3:179031989-179032011 GAGGGGGAGGGGGAGGAGGAGGG - Intronic
966350833 3:179032007-179032029 GAGGGGGAGGGGGAGGAGGAGGG - Intronic
966724673 3:183099065-183099087 GAGGGGAGCCTGGAGGATGGCGG + Intronic
966908476 3:184544503-184544525 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
966908524 3:184544619-184544641 GAGGGGGAGAAGGAGGAGGAGGG - Intronic
966981353 3:185139125-185139147 GAGGGGGAGCGGGAGGAGGAAGG + Intronic
967553806 3:190831446-190831468 GAGGGGGCCCTGGAAGAGGAGGG - Intergenic
967989418 3:195120229-195120251 GAGGGGCACCCCCAGGAGGATGG - Intronic
968232265 3:197010989-197011011 GAGTGGTGCCTGGAGGACCAAGG + Intronic
968563424 4:1296647-1296669 GAGTAGTAGCTGGAGGAGGACGG - Intronic
968709095 4:2099611-2099633 GAGGGGGTCCTGGAGCAGAAAGG + Intronic
968730424 4:2266991-2267013 GAAGGCTTCCTGGAGGAGGTGGG + Intergenic
968889374 4:3359380-3359402 GAGGGGGAGGGGGAGGAGGAAGG - Intronic
968953741 4:3707817-3707839 GAGGGGGTTCTGGAGGAGGCTGG + Intergenic
969301620 4:6300484-6300506 GAGGGCCACCTGGAGAAGGGGGG + Intronic
969370943 4:6731310-6731332 TAGGGTTGCCTAGAGGAGGAAGG + Intergenic
969454721 4:7294717-7294739 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
969454792 4:7294899-7294921 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
969607157 4:8208084-8208106 GAGGGTTGCCAGGTGGAGGATGG - Intronic
969620505 4:8276536-8276558 GAGGGCTTCCTGTAAGAGGAGGG + Intronic
969624914 4:8297520-8297542 GAGGGGTGCTGGGAGGAGGCTGG + Intronic
969704061 4:8782571-8782593 GAGGGGGAACTGGAGTAGGGAGG + Intergenic
969986557 4:11217498-11217520 GCGGGGGACCTGGAGCAGGCAGG + Intergenic
970132184 4:12884446-12884468 CAGGGGCACCTGGGGCAGGAGGG - Intergenic
970914891 4:21321580-21321602 GAGGGGTAGGAGGAGGAAGAGGG + Intronic
971002693 4:22340360-22340382 GAGGAGAACGAGGAGGAGGAGGG + Intergenic
971969495 4:33603715-33603737 CACAGGTAGCTGGAGGAGGATGG + Intergenic
972050583 4:34727767-34727789 GATGTTTTCCTGGAGGAGGAGGG + Intergenic
972320106 4:37965515-37965537 CAGGGGTACCTTGAAGTGGAGGG + Intronic
973675412 4:53256902-53256924 GAGGGGGACGGGGAGGGGGAGGG + Intronic
973754714 4:54063975-54063997 AAGGGGTGTGTGGAGGAGGAAGG + Intronic
974112201 4:57538051-57538073 GAGGAGGATCAGGAGGAGGAGGG - Intergenic
974229253 4:59088889-59088911 GAGGGGGAGGAGGAGGAGGAAGG - Intergenic
975139341 4:70903385-70903407 GAGGGGAACGTGGAGGGGGAAGG + Intronic
976056101 4:81069299-81069321 GATAAGTACCTGGAGGAGGTAGG - Intergenic
976751002 4:88451286-88451308 GCAGTGTACCTGGAGGAGTATGG - Intergenic
978157394 4:105505589-105505611 GGGGGGTATGTGGAGGGGGACGG - Intergenic
978464498 4:108994126-108994148 GAGGGCTACCTGAAGCAGGGAGG + Intronic
978619294 4:110622788-110622810 GAGGGGTTCTTGGGGGAGGGAGG - Exonic
980404942 4:132344292-132344314 GAGAGGAACCTCTAGGAGGAGGG - Intergenic
980420504 4:132553555-132553577 GAGGGGTACTAAGAGGAGGCTGG - Intergenic
981913389 4:150008194-150008216 GAGGGGTAACTGGAGAAGCAGGG - Intergenic
983881502 4:172938295-172938317 GAGGAGGAGGTGGAGGAGGAGGG + Intronic
984551964 4:181171301-181171323 GAGGAGCACCAGGAAGAGGATGG - Intergenic
984978918 4:185258369-185258391 GGAGGGCAACTGGAGGAGGAAGG - Intronic
986307937 5:6529261-6529283 GAAGGGAACCAGGAGGAGCAGGG - Intergenic
986330114 5:6711793-6711815 GAGGGGTGGAGGGAGGAGGAGGG + Intergenic
986742387 5:10715371-10715393 GAGTGGCACCTGGAGGTGGGTGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987032882 5:13991587-13991609 GAGGGGGAAGAGGAGGAGGAAGG + Intergenic
988906378 5:35794903-35794925 GAGGGGGACCTGAGGGCGGAAGG - Intronic
989983164 5:50666903-50666925 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
990119443 5:52431937-52431959 AAGGGGATCCTGGAGGATGAGGG - Intergenic
991082484 5:62616050-62616072 GAGGGGGAGGTGGGGGAGGAAGG + Intronic
991351094 5:65721799-65721821 GCCGGGTACCTGAGGGAGGACGG - Intronic
992102056 5:73417589-73417611 GAGGAATTCCTGGAGGAGGGAGG + Intergenic
992954017 5:81889572-81889594 GAGGGGTAGCTGTCAGAGGAGGG + Intergenic
994066228 5:95545682-95545704 GTGGGGTTGCTGAAGGAGGAAGG - Intronic
995314550 5:110753257-110753279 GAGAGGTAACTGGAAGATGAGGG + Intronic
997436629 5:133880387-133880409 GAGGGCTTCCTGGAGGAGGCAGG - Intergenic
997469492 5:134108929-134108951 GAGGGCTTCCTGGAGGAAGGAGG - Intergenic
997756353 5:136403162-136403184 GAGGGGAGGCTGGAGGTGGATGG + Intergenic
998472505 5:142394172-142394194 GAGGGGGAGGTGGAGGTGGAGGG - Intergenic
999237547 5:150108074-150108096 GAGAGATACAGGGAGGAGGAAGG + Intronic
999249711 5:150175406-150175428 AAGGTGGCCCTGGAGGAGGAGGG + Intronic
999262158 5:150244931-150244953 GAGGGGGGACTGGAGGAGGGTGG - Intronic
999553897 5:152720471-152720493 GAGGGGATCCCGGAGGAGAATGG - Intergenic
999629096 5:153551732-153551754 CAGGGGTTCAGGGAGGAGGATGG - Intronic
1000961157 5:167602890-167602912 GAGGGCTTCCTGGAAGAGAATGG + Intronic
1001565330 5:172696266-172696288 GAGGGGTAGCTGGTGTAGCAGGG - Intergenic
1001647722 5:173294780-173294802 GAGGGCTTCCTGGAGTAGGTGGG + Intergenic
1001706044 5:173741758-173741780 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1002254416 5:177948803-177948825 GAGGGGGACATGGAGGAGAGCGG - Intergenic
1002483577 5:179519009-179519031 GAGGGGGACATGGAGGAGAGCGG + Intergenic
1002591887 5:180296123-180296145 GGGGGATTCCCGGAGGAGGAGGG - Intergenic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1003097803 6:3156380-3156402 GGAGGGGCCCTGGAGGAGGAGGG + Intronic
1003101533 6:3179938-3179960 GGAGGGGCCCTGGAGGAGGAGGG + Intergenic
1003894238 6:10591665-10591687 GAGTGGTACTAGCAGGAGGAGGG - Intronic
1005282187 6:24286156-24286178 GAGGGGCTCCTAGAGGAAGATGG - Intronic
1005987582 6:30884267-30884289 GCGGGTTACCTGGGGGAGGCCGG + Intronic
1006188205 6:32192154-32192176 GGCGGGTCCCTGGAGGAGGAGGG + Exonic
1006332767 6:33404187-33404209 GAGGGGTACCTGGAAGGGAGGGG - Intronic
1006384677 6:33723773-33723795 GAGGGGAGCCTGGTGGAGGAGGG + Intronic
1006457361 6:34139496-34139518 GCAGGCTTCCTGGAGGAGGAAGG - Intronic
1006689030 6:35863624-35863646 GAGGGGGAGGTGGAGGGGGAGGG + Intronic
1007070864 6:39037346-39037368 GAGGGGGAGAGGGAGGAGGAGGG - Intergenic
1007198266 6:40082438-40082460 GAGTGGTCCCAGGTGGAGGAGGG - Intergenic
1007500846 6:42295600-42295622 GAGGGCTTCCTGGATGAGGCTGG - Intronic
1007622043 6:43221308-43221330 GAGGGGTGCCTGCAGTAAGAAGG + Exonic
1007978869 6:46130090-46130112 AAGGGGGACCTGGAGGAAGAGGG - Exonic
1008090202 6:47286027-47286049 GAGGTGGAGCTGGAGAAGGACGG + Exonic
1008632991 6:53381750-53381772 GAGGGATACCTGAAGGTGCAGGG - Intergenic
1008759169 6:54833473-54833495 GAGGGGGAAAAGGAGGAGGAGGG + Intergenic
1009890382 6:69673556-69673578 GTGGGCAACCTGGGGGAGGAGGG + Intergenic
1011325975 6:86150429-86150451 GGGGTGGACCTGGAGGAGAAGGG + Intergenic
1013292026 6:108728136-108728158 GAGGGGGACTTGGAGGCAGAAGG + Intergenic
1013775395 6:113673629-113673651 GAGGGGCCCCTGGAGGAGCTGGG + Intergenic
1014242439 6:119032616-119032638 GAGGGGGAGGAGGAGGAGGAAGG + Intronic
1016452809 6:144200868-144200890 GGGCTGTACCTGGAGGTGGAGGG - Intergenic
1016979762 6:149843485-149843507 GTAGGGTACCAGGAGGAGGTGGG - Intronic
1017670861 6:156768394-156768416 GAAGTCTACCTGGAGGAAGATGG + Intergenic
1017724483 6:157267581-157267603 GAAGGTTACTTGGAGGAAGAGGG + Intergenic
1017962323 6:159233195-159233217 ATGGGCTGCCTGGAGGAGGAAGG - Exonic
1018383848 6:163285159-163285181 GAGGGGTGTCTGGGGGAGGCTGG - Intronic
1019551828 7:1606909-1606931 GAGGGGTAGGAGGAGGGGGAGGG - Intergenic
1019777251 7:2919192-2919214 AAGGGCTTCCTGGAGGAGGAGGG + Intronic
1019951234 7:4374551-4374573 GAGGATGACCTTGAGGAGGAAGG - Intergenic
1020035209 7:4959788-4959810 GTGGGGGACCTGGGGGTGGAGGG + Intergenic
1020035231 7:4959838-4959860 GTGGGGGACCTGGGGGTGGAGGG + Intergenic
1020035284 7:4959960-4959982 GAAGGGGAACTGGAGGTGGAGGG + Intergenic
1020035352 7:4960129-4960151 GCGGGGGACCTGGGGGTGGAGGG + Intergenic
1020084539 7:5303365-5303387 GAGGGGTCCCTGGTGGAGGCTGG - Exonic
1020575247 7:9917945-9917967 GAAGGGTATCTGGAAGAGAAAGG + Intergenic
1021100335 7:16581427-16581449 GAAAGGTACCTTGAAGAGGAAGG + Exonic
1022764328 7:33393775-33393797 GAGGGCTAACTGCAGGATGATGG - Intronic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1023839065 7:44085762-44085784 GAGGTATACCTGCTGGAGGAGGG + Intergenic
1024044848 7:45579466-45579488 GAGGGGTCCGTGGGGGAGTAGGG - Intronic
1024886490 7:54148160-54148182 AAGGGGTACATGGGGGAGGTAGG + Intergenic
1025209764 7:57013834-57013856 GAGGGGTCCCTGATGGAGGCTGG + Intergenic
1025228329 7:57182211-57182233 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1025662189 7:63563017-63563039 GAGGGGTCCCTGATGGAGGCTGG - Intergenic
1026063532 7:67048185-67048207 AAAGGGTACCTAGGGGAGGATGG - Intronic
1026159016 7:67852618-67852640 GAGGGATAAGTTGAGGAGGATGG + Intergenic
1026714817 7:72779289-72779311 AAAGGGTACCTAGGGGAGGATGG + Intronic
1027164260 7:75823421-75823443 GAGGGGCACCTGGGGAGGGAAGG + Intergenic
1027249469 7:76389989-76390011 GAGGGCTTCCTGGAGGAGGAAGG + Exonic
1027581811 7:80006104-80006126 AAGTGGTACCTGGAGGAGTTGGG + Intergenic
1029147394 7:98456570-98456592 GAGGGGCTCAGGGAGGAGGAGGG + Intergenic
1029514672 7:101017826-101017848 AAGGGGTCCCAGGGGGAGGAAGG - Intronic
1029514796 7:101018072-101018094 GAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514890 7:101018255-101018277 GAGGGAGTCCTGGGGGAGGAGGG - Intronic
1029514932 7:101018371-101018393 GAGGGAGTCCTGGGGGAGGAGGG - Intronic
1029515900 7:101022836-101022858 GAAGGCTCCCTGGAGGAGGTGGG - Intronic
1029647958 7:101869912-101869934 GCGGGGCACCTGGAAGGGGATGG - Intronic
1029684334 7:102135441-102135463 GAGGAGGACGTGGAGGAGGTGGG + Intronic
1031313293 7:120226925-120226947 TAGGGGAGCCTAGAGGAGGAAGG - Intergenic
1031595076 7:123640666-123640688 GAGGGGGAGGGGGAGGAGGAGGG + Intergenic
1031597305 7:123662861-123662883 GAGGGGGAGGAGGAGGAGGAGGG - Exonic
1032128305 7:129210531-129210553 GAGGCGTACCTGGTGCAGGTGGG + Exonic
1032523858 7:132564411-132564433 GAAGGGCTCCTGGAGAAGGAGGG - Intronic
1032698079 7:134355060-134355082 GAGGGGTACTGGGCAGAGGAAGG + Intergenic
1033870800 7:145751587-145751609 GGGGTGGACCTGGAGGAGCAGGG + Intergenic
1034014369 7:147566305-147566327 GAGGAGTAAGAGGAGGAGGAGGG + Intronic
1034014378 7:147566323-147566345 GAGGGGTAGAGGGAGGGGGAGGG + Intronic
1034224316 7:149471065-149471087 GAGTGATTCCTGTAGGAGGAAGG + Intergenic
1034267095 7:149786319-149786341 GAGGGAGACCAGGAGGAGGGAGG - Intergenic
1034439358 7:151078785-151078807 GAGGGCTGACAGGAGGAGGAAGG - Intronic
1034563934 7:151898750-151898772 GGGCAGTACCTGGAGGGGGATGG - Intergenic
1034589371 7:152127037-152127059 CAGGGGTCCCTGGGGGAGGGAGG + Intergenic
1034720777 7:153290188-153290210 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1034999853 7:155604015-155604037 GAGGGGTTCCTAGAGGAGTCAGG - Intergenic
1035722033 8:1799270-1799292 GAGGGGGACGGGGAGGGGGAGGG - Intergenic
1036206860 8:6811871-6811893 GAGGGGTCACGGGATGAGGATGG + Exonic
1036605572 8:10302807-10302829 AATGGGTACCTGGTGGAAGAGGG + Intronic
1036687904 8:10924095-10924117 GAGAGGGCCCAGGAGGAGGAGGG - Intronic
1037884755 8:22590040-22590062 GAGGGCTTCTTGGAGGAAGAGGG + Intronic
1037908597 8:22729779-22729801 GGGGAGGACCTGGTGGAGGAGGG + Intronic
1038012387 8:23485381-23485403 GAAGGGTACCTGGAGAATGATGG - Intergenic
1038276844 8:26128264-26128286 GAGGAGGAGGTGGAGGAGGAAGG + Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038761119 8:30384788-30384810 GAGGGCGACCTGGAGAGGGAGGG - Exonic
1039112264 8:34052834-34052856 GAGGGGGAGAGGGAGGAGGAGGG + Intergenic
1039203495 8:35123253-35123275 GGGGAGTATCTGGAGAAGGAAGG + Intergenic
1039257330 8:35733801-35733823 GAGGGGTACAGGGGTGAGGATGG + Intronic
1039568414 8:38567003-38567025 GAGGAGCAGGTGGAGGAGGAAGG + Intergenic
1039659866 8:39449914-39449936 GAGGTGGACCTGGAGGAGCAGGG - Intergenic
1039893358 8:41699173-41699195 GAGGGGAGCCTGGGAGAGGATGG + Intronic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1040390192 8:46942913-46942935 GAGGGGTACCTGGACGTGTGAGG - Intergenic
1040443900 8:47473804-47473826 GTGAGGAACCAGGAGGAGGATGG + Intronic
1040550286 8:48432187-48432209 ATGGGCTTCCTGGAGGAGGAGGG + Intergenic
1040860954 8:51998932-51998954 GAGGGGTGGCTGGAGGGAGAAGG + Intergenic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1042176532 8:66042710-66042732 GAGGGGTGCGAGGAGGGGGAGGG - Intronic
1042390889 8:68232173-68232195 GAGGGGAACCAGGATGAAGAAGG + Exonic
1042965740 8:74350352-74350374 GAGGGGTACCTGCCGGAAGGAGG - Intronic
1044659190 8:94578730-94578752 GAGGGCAACCTGGAGGGGGCTGG + Intergenic
1045023507 8:98064489-98064511 GGTGCGCACCTGGAGGAGGAAGG - Exonic
1045111454 8:98941696-98941718 GAGGAGGAGGTGGAGGAGGAGGG - Intronic
1045474644 8:102542581-102542603 GAGGAGTAGGGGGAGGAGGAGGG - Intergenic
1046100521 8:109609128-109609150 GAGAGGTAATTGCAGGAGGAGGG - Intronic
1047520433 8:125591700-125591722 GAGGAGGAGGTGGAGGAGGAAGG + Intergenic
1048286156 8:133143242-133143264 GAAGGACACCTGAAGGAGGAAGG - Intergenic
1048850452 8:138640559-138640581 GAAGGCCACCTGGAGGAGGTAGG - Intronic
1049191063 8:141287872-141287894 CAGGGGCACCTGGAGGAAGACGG + Intronic
1049199707 8:141334087-141334109 AAGGACTTCCTGGAGGAGGAGGG + Intergenic
1049214802 8:141402658-141402680 GAGGGGTAGCCAGAGGCGGAAGG - Intronic
1049244119 8:141552381-141552403 GAGGGGTGCCTGGAGAAGCAAGG - Intergenic
1049352197 8:142170343-142170365 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1049386076 8:142343793-142343815 GAGGGGGAGGAGGAGGAGGAGGG + Intronic
1049454842 8:142681594-142681616 GAGTGGCAGATGGAGGAGGATGG - Intronic
1049499243 8:142952700-142952722 GAGGGGAACCTGGGGGATGGTGG - Intergenic
1049558182 8:143294084-143294106 GAGGGGCAGCAGGAGGAGGGGGG - Intronic
1050421653 9:5471954-5471976 GTGGGGTACGGGGAGGAGGGAGG - Intergenic
1051355968 9:16239996-16240018 GAGGGTTGCGGGGAGGAGGAGGG - Intronic
1052918114 9:33939755-33939777 GAGGGGGAGGGGGAGGAGGAAGG + Intronic
1052918163 9:33939854-33939876 GAGGGGGAGGAGGAGGAGGAGGG + Intronic
1053160426 9:35810136-35810158 GAGGAGTGCCAGGATGAGGATGG + Intronic
1053298854 9:36934660-36934682 GAGGGCTTCCTGGAAGAGGAAGG - Intronic
1053372793 9:37576469-37576491 GAGGGGCACCGGGAGGCGGGAGG + Intronic
1054453103 9:65413673-65413695 GAGGGGTACAGGGAGGTGGCAGG + Intergenic
1054901158 9:70370779-70370801 GAGGGGAAAGGGGAGGAGGAGGG + Intergenic
1055581454 9:77711079-77711101 AAGGGGGACAGGGAGGAGGAGGG - Intergenic
1057174367 9:92985221-92985243 TAGGGAAACCTGGAGGAGGCTGG + Intronic
1057185540 9:93055633-93055655 GAGGGCTCCATGGAGAAGGAGGG + Intergenic
1057477059 9:95411778-95411800 GATGAGGACCTGGAGGCGGAGGG + Intergenic
1057505319 9:95628516-95628538 GAGGAGGACGAGGAGGAGGAGGG - Intergenic
1059072441 9:111152885-111152907 GAGGTGGAGGTGGAGGAGGAGGG + Intergenic
1059365192 9:113781388-113781410 GAAGGCTTCCTGAAGGAGGAGGG - Intergenic
1059458695 9:114415930-114415952 GAGGGGTCCCTGCAGCTGGAGGG + Intronic
1060561554 9:124549136-124549158 GAGGGTTATCTGGTGGGGGATGG + Intronic
1060583238 9:124770667-124770689 GAGGGGACCCGGGGGGAGGAGGG + Intronic
1060736130 9:126067526-126067548 GAGGCCTTCCTGGAGGAGGAGGG - Intergenic
1060852040 9:126886224-126886246 GGCTGGAACCTGGAGGAGGAGGG - Intergenic
1061133438 9:128720789-128720811 GAGGGCGAGCTGGAGGGGGAAGG - Exonic
1061194229 9:129098727-129098749 GATGGGTACCTGAAGCTGGAGGG + Intronic
1061366218 9:130173386-130173408 GCGGGCTGCCCGGAGGAGGATGG + Intronic
1061621712 9:131814884-131814906 GAAGGCTTCCTGGAGGAAGAGGG - Intergenic
1061678463 9:132231155-132231177 GAGGGGCATCTGCAGGAGGTGGG + Intronic
1061865759 9:133491074-133491096 GAGGAGGAGTTGGAGGAGGAGGG + Intergenic
1061865785 9:133491149-133491171 GAGGAGGACTTGGAGGAGGAGGG + Intergenic
1061908072 9:133708896-133708918 GGGGGGTTCCTTGATGAGGAGGG - Intronic
1061913148 9:133735366-133735388 GAGGGTTTCCTGAAGGAGGAGGG - Intronic
1061967582 9:134025059-134025081 GAGGAGGAGATGGAGGAGGAGGG - Intergenic
1061967647 9:134025284-134025306 GAGGAGGGGCTGGAGGAGGAGGG - Intergenic
1061967653 9:134025299-134025321 GAGGAGGGGCTGGAGGAGGAGGG - Intergenic
1062097842 9:134712056-134712078 GAGGGGTACAGGAAGGAGGGAGG - Intronic
1062198296 9:135286872-135286894 GAGGGAGGCCTGGGGGAGGATGG - Intergenic
1062277616 9:135738164-135738186 GAGGGCTTCCTGGAGGAGGTGGG - Intronic
1062421883 9:136486597-136486619 GAGCTCTTCCTGGAGGAGGAGGG + Intergenic
1062469737 9:136697070-136697092 GAGGGGGAGGGGGAGGAGGAGGG - Intergenic
1062543271 9:137050893-137050915 GAGGGGCACCTGGAGGGCGCTGG + Exonic
1062546254 9:137064948-137064970 CAGGGGGGCCCGGAGGAGGACGG + Exonic
1062567871 9:137171296-137171318 GTGCTGTCCCTGGAGGAGGAGGG - Intronic
1062567879 9:137171319-137171341 GGGGAGTCCCTGGAGGAGGAGGG - Intronic
1062576726 9:137212313-137212335 GATGGGCACCGGGAGGAGGCAGG - Intronic
1062616068 9:137396463-137396485 GAGGGCTGCCTGGGGGAGGGCGG - Intronic
1062737068 9:138143440-138143462 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1185499055 X:583980-584002 GAGGAGGAGGTGGAGGAGGAGGG + Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1186174473 X:6910624-6910646 GAAGGCTCCCTGGAGGAGGAAGG + Intergenic
1190248312 X:48705183-48705205 GAGGGGTCTCTGGAGAAGGGAGG + Intronic
1191871796 X:65752366-65752388 TAGGGCTACCTGGAGGGGGTTGG - Intergenic
1192302666 X:69921958-69921980 CAGAGGTATGTGGAGGAGGAGGG - Intronic
1192756967 X:74056523-74056545 GAGGAATACAGGGAGGAGGAAGG - Intergenic
1194112123 X:89847537-89847559 GAGGCCTACCTGAAGGTGGAGGG + Intergenic
1195119717 X:101738364-101738386 GAGGGGGAGGGGGAGGAGGAGGG - Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1197783244 X:130177090-130177112 GATGGGGTGCTGGAGGAGGATGG - Intronic
1198222370 X:134614095-134614117 GAAGGCTTCCTGGAGGAGGTGGG - Intronic
1198491630 X:137147195-137147217 GAGAGGGACCTGGAGTAGGCAGG + Intergenic
1199088240 X:143657831-143657853 TAGGCGTAGCTGCAGGAGGATGG + Intergenic
1199869634 X:151886703-151886725 GAAGGGTACCTGCAGGAGGTAGG + Intergenic
1199872752 X:151913310-151913332 GATGGGGAGCTGGTGGAGGATGG - Intronic
1200050340 X:153426149-153426171 GAGGGGTTGCTGGAGGCGCAAGG - Intergenic
1200399255 X:156009701-156009723 GAGGGCTTCCTGGAGGAGGAGGG + Intronic
1200464778 Y:3502317-3502339 GAGGCCTACCTGAAGGTGGAGGG + Intergenic