ID: 924985760

View in Genome Browser
Species Human (GRCh38)
Location 2:268056-268078
Sequence TTTTAGGTCCAGATCTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 414}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924985753_924985760 -5 Left 924985753 2:268038-268060 CCGATTTTCAGACCCCTGTTTTA 0: 1
1: 0
2: 2
3: 17
4: 233
Right 924985760 2:268056-268078 TTTTAGGTCCAGATCTTGGGAGG 0: 1
1: 0
2: 0
3: 24
4: 414
924985752_924985760 2 Left 924985752 2:268031-268053 CCATGAGCCGATTTTCAGACCCC 0: 1
1: 0
2: 0
3: 11
4: 96
Right 924985760 2:268056-268078 TTTTAGGTCCAGATCTTGGGAGG 0: 1
1: 0
2: 0
3: 24
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924985760 Original CRISPR TTTTAGGTCCAGATCTTGGG AGG Intronic
900086190 1:898664-898686 GTTTATGGCCAGATTTTGGGGGG + Intergenic
900153450 1:1192070-1192092 GTTTATGGCCAGATTTTGGGGGG + Intronic
900466541 1:2828404-2828426 GTTTATGGCCAGATTTTGGGGGG + Intergenic
900680995 1:3916091-3916113 TATTCGGTCCAGAACTCGGGTGG + Intergenic
902390694 1:16103293-16103315 GTTTATGGCCAGATTTTGGGGGG + Intergenic
902391322 1:16108777-16108799 GTTTATGGCCAGATTTTGGGGGG + Intergenic
903166584 1:21524697-21524719 TTTTGGAGCCAGATCTGGGGAGG + Intronic
904572858 1:31480373-31480395 GTTTATGGCCAGATTTTGGGGGG - Intergenic
904574275 1:31492925-31492947 GTTTATGGCCAGATTTTGGGGGG + Intergenic
905055134 1:35087111-35087133 CTGTAGTTCCAGCTCTTGGGAGG - Intronic
905843198 1:41203524-41203546 GTTTATGACCAGATTTTGGGGGG - Intronic
906043095 1:42804670-42804692 GTTTATGGCCAGATTTTGGGGGG + Intergenic
906774190 1:48513723-48513745 GTTTATGGCCAGATTTTGGGGGG + Intergenic
906840743 1:49135857-49135879 GTTTACGGCCAGATTTTGGGAGG + Intronic
906892275 1:49730278-49730300 TTTTAGCTCCTGCTCTTTGGTGG - Intronic
907353691 1:53854476-53854498 TTTTGGCTCCCCATCTTGGGTGG + Intronic
908369748 1:63469806-63469828 GTTTACGGCCAGATTTTGGGGGG - Intronic
909048521 1:70739541-70739563 GTTTATGGCCAGATTTTGGGGGG + Intergenic
909098169 1:71315813-71315835 GTTTATGGCCAGATTTTGGGCGG + Intergenic
911283382 1:95959267-95959289 GTTTATGGCCAGATTTTGGGAGG - Intergenic
911600768 1:99845539-99845561 GTTTATGGCCAGATGTTGGGAGG + Intergenic
912856459 1:113172848-113172870 GTTTATGGCCAGATTTTGGGGGG - Intergenic
915079525 1:153342318-153342340 TTTTATCTCCAGCTCCTGGGTGG - Intronic
915261446 1:154679419-154679441 GTTTATGGCCAGATTTTGGGGGG - Intergenic
915379618 1:155428479-155428501 GTTTATGGCCAGATTTTGGGGGG - Intronic
916045496 1:160997202-160997224 TTTGAAGACCAGATCATGGGTGG - Exonic
918234906 1:182571239-182571261 GTTTATGGCCAGATTTTGGGGGG - Intergenic
920413058 1:205777250-205777272 GTTTATGGCCAGATTTTGGGGGG + Intergenic
920428161 1:205895662-205895684 GTTTATGGCCAGATTTTGGGGGG - Intergenic
921226565 1:213025957-213025979 GTTTATGGCCAGATTTTGGGGGG + Intergenic
921227259 1:213032406-213032428 GTTTATGGCCAGATTTTGGGGGG + Intergenic
923072513 1:230578420-230578442 ATTAAAGTCCAGAGCTTGGGTGG - Intergenic
1063314335 10:4986608-4986630 GTTTATGGCCAGATTTTGGGGGG + Intronic
1063468368 10:6263452-6263474 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1063824777 10:9883299-9883321 TTTTAAGTCCAGATATGGAGTGG + Intergenic
1064770134 10:18714357-18714379 TTATAGTTTCAGCTCTTGGGAGG + Intergenic
1066619273 10:37326754-37326776 GTTTATGGCCAGATTTTGGGGGG - Intronic
1066989746 10:42501723-42501745 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1066990282 10:42506547-42506569 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1066990741 10:42510703-42510725 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1068075476 10:52248267-52248289 GTTTATGGCCAGATTTTGGGGGG + Intronic
1068104587 10:52598046-52598068 TTTTCGATCCATATCTTAGGAGG + Intergenic
1068166229 10:53336070-53336092 GTTTATGCCCAGATTTTGGGGGG + Intergenic
1068445613 10:57118979-57119001 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1068675479 10:59765277-59765299 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1069070257 10:63984881-63984903 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1069172168 10:65245662-65245684 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1070895008 10:79976050-79976072 GTTTATGGCCAGATTTTGGGGGG + Intronic
1070947034 10:80401037-80401059 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1072112011 10:92331431-92331453 TTTTAGGTAAAGATTATGGGGGG - Intronic
1072654080 10:97318712-97318734 TTTTTGATCGAGATCCTGGGCGG - Intergenic
1072934707 10:99701076-99701098 TTTTAAGTCCACATCTAAGGAGG - Intronic
1074268524 10:111929471-111929493 TGTTAGGTCCAGCTCATGAGGGG - Intergenic
1075014030 10:118896969-118896991 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1075288543 10:121208514-121208536 TTCTAGGTACAGAGCCTGGGAGG + Intergenic
1076416128 10:130290823-130290845 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1076416844 10:130297306-130297328 GTTTACGGCCAGATTTTGGGGGG - Intergenic
1076505881 10:130972264-130972286 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1077210102 11:1366851-1366873 GTTTATGGCCAGATTTTGGGAGG + Intergenic
1078048070 11:7936315-7936337 TTTGAAGTCCAGATCTTTGGAGG - Intergenic
1078132940 11:8628314-8628336 ATTTAGATCCAGATCTTGGTTGG + Intronic
1078206501 11:9234518-9234540 GTTTATGGCCAGATTTTGGGGGG - Intronic
1078561154 11:12374225-12374247 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1079830729 11:25264175-25264197 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1080106237 11:28513971-28513993 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1081328096 11:41770335-41770357 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1082560855 11:54618945-54618967 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1086066359 11:82749439-82749461 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1087901924 11:103650916-103650938 TTGAAGGTCCAGATCATGGGAGG + Intergenic
1088216670 11:107518420-107518442 GTTTATGGCCAGATTTTGGGGGG - Intronic
1088491828 11:110396232-110396254 GTTTATGGCCAGATCTTGGGGGG - Intergenic
1090037188 11:123259348-123259370 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1092292620 12:7171567-7171589 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1092309964 12:7342115-7342137 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1092568629 12:9697110-9697132 GTTTATGGCCAGATTTTGGGGGG - Intronic
1093215295 12:16354938-16354960 TTTTAAGTGCAGATGTGGGGAGG + Intronic
1094573890 12:31666003-31666025 GTTTATGGCCAGATTTTGGGGGG + Intronic
1094821306 12:34228074-34228096 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1095184832 12:39189457-39189479 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1095186041 12:39201187-39201209 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1095780964 12:46059070-46059092 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1095913126 12:47448732-47448754 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1096125086 12:49113226-49113248 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1096441928 12:51650591-51650613 GTTTATGGCCAGATTTTGGGGGG - Intronic
1096442034 12:51651231-51651253 GTTTATGGCCAGATTTTGGGGGG + Intronic
1096450285 12:51734676-51734698 GTTTATGGCCAGATTTTGGGGGG + Intronic
1096450917 12:51740237-51740259 GTTTATGGCCAGATTTTGGGGGG + Intronic
1097816122 12:64075486-64075508 GTTTATGGCCAGATTTTGGGGGG + Intronic
1098246585 12:68525306-68525328 TTTTGGGGCCAGATTTTGGGGGG - Intergenic
1099724184 12:86403679-86403701 TTTTAGGTATAGATTTTGGAAGG + Intronic
1100306128 12:93351765-93351787 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1101223893 12:102668153-102668175 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1101500988 12:105303309-105303331 GTTTATGGCCAGATTTTGGGGGG + Intronic
1101767060 12:107711375-107711397 GTTTATGGCCAGATTTTGGGGGG + Intronic
1104446276 12:128836211-128836233 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1104505623 12:129329564-129329586 TCTTAAGTCCAGATCTTAGTGGG + Intronic
1105282597 13:18977107-18977129 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1105352732 13:19630731-19630753 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1105738542 13:23297743-23297765 GTTTAAGGCCAGATTTTGGGGGG + Intronic
1105757269 13:23478684-23478706 CTGTAGTTCCAGCTCTTGGGAGG - Intergenic
1106596674 13:31147477-31147499 TTTTTGGTACATATTTTGGGGGG - Intronic
1110027849 13:70564942-70564964 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1110738289 13:78964142-78964164 TTTTTGGTCCAGATCTGGCATGG - Intergenic
1111277039 13:85963705-85963727 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1111415951 13:87944062-87944084 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1111447907 13:88374049-88374071 TTTTATGGCCAGATTTTGGGTGG - Intergenic
1111690091 13:91552838-91552860 GTTTATGGCCAGATTTTGGGGGG + Intronic
1113830065 13:113288663-113288685 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1113923163 13:113925831-113925853 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1114028894 14:18557710-18557732 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1114494953 14:23126158-23126180 TTTTAGGCCAAGTTCTTGGATGG + Exonic
1115128325 14:30023330-30023352 GTTTATGGCCAGATTTTGGGGGG - Intronic
1115176438 14:30566765-30566787 GTTTTGTTCCAGATCTTAGGTGG + Intronic
1115959439 14:38819252-38819274 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1116232537 14:42235627-42235649 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1116354563 14:43912617-43912639 TTAAAGGACCAGATCTTGTGAGG - Intergenic
1116664290 14:47754806-47754828 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1117600132 14:57365970-57365992 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1117718064 14:58600926-58600948 TTTTAAGTCCAGTTCTTGCCAGG - Intergenic
1118538325 14:66793159-66793181 GTTTATGGCCAGATTTTGGGGGG + Intronic
1119562393 14:75601395-75601417 GTTTATGGCCAGATTTTGGGGGG + Intronic
1120261268 14:82189097-82189119 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1122652660 14:103234011-103234033 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1122653259 14:103238987-103239009 GTTTATGGCCAGATTTTGGGAGG - Intergenic
1123102881 14:105817834-105817856 ATTTCTGTCCAGGTCTTGGGGGG + Intergenic
1123177782 14:106438162-106438184 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1123673470 15:22684293-22684315 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1124325472 15:28757278-28757300 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1125755458 15:42061208-42061230 TCTTAGGATCAGAACTTGGGAGG - Intergenic
1126052667 15:44700940-44700962 TTCTATGTCCAGTTTTTGGGGGG + Intronic
1126834713 15:52648588-52648610 TTTGAGGTTCAAATTTTGGGTGG - Intronic
1126841947 15:52725755-52725777 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1126906670 15:53375352-53375374 TTATAAGACCAGATCTTGGCTGG + Intergenic
1129051657 15:72786167-72786189 TTCCAGGTCAGGATCTTGGGTGG - Intergenic
1129792321 15:78349626-78349648 GTTTATGGCCAGATTTTGGGAGG + Intergenic
1129821610 15:78605947-78605969 TTTTAGGGCAAGTTCTTGGGGGG - Intronic
1130080217 15:80726345-80726367 GTTTATGGCCAGATTTTGGGGGG + Intronic
1130999208 15:88925007-88925029 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1133044232 16:3077313-3077335 GTTTATGGCCAGATCTTGGGGGG + Intronic
1133936363 16:10272584-10272606 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1134315550 16:13115646-13115668 GTTTATGGCCAGATTTTGGGAGG + Intronic
1136410019 16:30070714-30070736 TTTTAGGTCCAGAACTCAAGGGG + Intergenic
1136743359 16:32559981-32560003 GTTTATGGCCAGATTTTGGGTGG + Intergenic
1139081314 16:63525008-63525030 GTTTAAGGCCAGATTTTGGGGGG - Intergenic
1140652740 16:77106469-77106491 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1141414237 16:83857771-83857793 TATTAGGTCCAGATGAAGGGAGG - Intergenic
1203026240 16_KI270728v1_random:515248-515270 GTTTATGGCCAGATTTTGGGTGG - Intergenic
1203045481 16_KI270728v1_random:819183-819205 GTTTATGGCCAGATTTTGGGTGG + Intergenic
1143074765 17:4331982-4332004 TTTTAGGTTCAGATCTCCTGGGG - Intronic
1143430127 17:6875625-6875647 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1143430761 17:6881495-6881517 GTTTATGGCCAGATTTTGGGGGG + Intronic
1143803812 17:9408536-9408558 TCTTAGGTCCAGAACTTTGATGG - Intronic
1145281240 17:21468446-21468468 ATTTATGGCCAGATTTTGGGAGG - Intergenic
1146525609 17:33564665-33564687 GTTTATGGCCAGATTTTGGGGGG - Intronic
1147397818 17:40158479-40158501 CCTTAGGTCCAAATCTGGGGAGG + Intronic
1149783462 17:59416564-59416586 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1151081894 17:71339125-71339147 TTTTCGGTAAAGATGTTGGGGGG + Intergenic
1152366023 17:79856939-79856961 ATTAAGGTGCAGATCTTGAGAGG + Intergenic
1152759765 17:82101695-82101717 TTGTAGTTACGGATCTTGGGGGG + Exonic
1155062139 18:22238123-22238145 TTTTAGGTTTAGGTCTGGGGAGG - Intergenic
1157900368 18:51509089-51509111 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1159195685 18:65110965-65110987 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1159219522 18:65441194-65441216 GTTTAGAACTAGATCTTGGGTGG - Intergenic
1159937621 18:74381695-74381717 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1161040001 19:2105238-2105260 GTTTATGGCCAGATTTTGGGGGG - Intronic
1161875760 19:6907949-6907971 GTTTATGGCCAGATTTTGGGGGG - Intronic
1162175055 19:8824138-8824160 TTTCAGGACCAGGTCTTGGAAGG + Exonic
1162282694 19:9711986-9712008 GTTTATGGCCAGATTTTGGGAGG + Intergenic
1162652285 19:12098806-12098828 GTTTATGGCCAGATTTTGGGGGG + Intronic
1162652892 19:12104257-12104279 GTTTATGGCCAGATTTTGGGGGG + Intronic
1163988109 19:20971619-20971641 TTTTAGGTCAAGTTCTCAGGGGG + Intergenic
1164031676 19:21412491-21412513 GTTTATGGCCAGATTTTGGGGGG + Intronic
1164060995 19:21673367-21673389 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1164261667 19:23573048-23573070 GTTTATGGCCAGATTTTGGGGGG + Intronic
1164289285 19:23852751-23852773 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1164322650 19:24163655-24163677 GTTTATGGCCAGATTTTGGGAGG + Intergenic
1165286051 19:34842632-34842654 TTCTACTTCCTGATCTTGGGGGG + Intergenic
1166252501 19:41581048-41581070 GTTTATGGCCAGATTTTGGGGGG - Intronic
1166659183 19:44634675-44634697 GTTTATGGCCAGATTTTGGGGGG + Intronic
1167123902 19:47536286-47536308 GTTTATGGCCAGATTTTGGGGGG + Intronic
924985760 2:268056-268078 TTTTAGGTCCAGATCTTGGGAGG + Intronic
925023616 2:590566-590588 TTTTGGGGCCAGACTTTGGGGGG + Intergenic
925785152 2:7424713-7424735 TTTCTAGTCCAGATTTTGGGAGG + Intergenic
927641440 2:24848073-24848095 GTTTATGGCCAGATTTTGGGGGG - Intronic
928833331 2:35515168-35515190 TTTTAATTCAAGATCTTTGGTGG + Intergenic
930316572 2:49803165-49803187 GTTTATGGCCAGATTTTGGGGGG + Intergenic
930918573 2:56723722-56723744 GTTTATGGCCAGATTTTGGGGGG - Intergenic
930993503 2:57687774-57687796 ATTTATGGCCAGATTTTGGGGGG - Intergenic
931359970 2:61569967-61569989 GTTTATGGCCAGATTTTGGGGGG - Intergenic
931365279 2:61613688-61613710 ATTCAGGTCCATATTTTGGGGGG + Intergenic
932384446 2:71318278-71318300 GTTTATGGCCAGATTTTGGGGGG + Intronic
933011377 2:77068744-77068766 GTTTATGGCCAGATTTTGGGGGG - Intronic
934552086 2:95268813-95268835 TTCTAAGTCCAGTTCTAGGGGGG + Intergenic
934931764 2:98431570-98431592 GTTTATGGCCAGATTTTGGGGGG + Intergenic
935301097 2:101694688-101694710 TTTGTGGTTCAGAGCTTGGGAGG - Intergenic
936800036 2:116255646-116255668 GTTTATGGCCAGATTTTGGGGGG - Intergenic
937170957 2:119868466-119868488 GTTTATGGCCAGATTTTGGGGGG - Intronic
937705676 2:124918145-124918167 TCTTAGGTCCAACTCATGGGAGG - Intergenic
940250491 2:151670270-151670292 TTTTAGCCCCAGATTTTGGAAGG - Intronic
940310528 2:152274105-152274127 GTTTACGGCCAGATTTTGGGGGG + Intergenic
940311114 2:152279727-152279749 GTTTATGGCCAGATTTTGGGGGG + Intergenic
941239068 2:163014702-163014724 GTTTATGGCCAGATTTTGGGGGG - Intergenic
941258133 2:163259299-163259321 GTTTATGGCCAGATTTTGGGGGG + Intergenic
943062198 2:183050744-183050766 GTTTATGGCCAGATTTTGGGGGG + Intergenic
943062578 2:183053732-183053754 GTTTATGGCCAGATTTTGGGGGG + Intergenic
943286476 2:186007951-186007973 GTTTATGGCCAGATTTTGGGGGG - Intergenic
943616698 2:190100984-190101006 AGTTAGCTCCAGAGCTTGGGAGG - Intronic
943901795 2:193447922-193447944 GTTTATGGCCAGATTTTGGGGGG + Intergenic
943903656 2:193472073-193472095 GTTTATGGCCAGATTTTGGGGGG - Intergenic
944480390 2:200152019-200152041 GTTTATGGCCAGATTTTGGGGGG - Intergenic
945790892 2:214304216-214304238 GTTTATGGCCAGATTTTGGGGGG - Intronic
946380777 2:219347280-219347302 GTTTATGGCCAGATTTTGGGGGG + Intergenic
946435736 2:219651713-219651735 GTTTATGGCCAGATTTTGGGGGG - Intergenic
946975044 2:225139115-225139137 GTTTATGGCCAGATTTTGGGGGG + Intergenic
947194582 2:227548390-227548412 GTTCAGGACCAGAGCTTGGGGGG + Intronic
947977958 2:234384137-234384159 GTTTATGGCCAGATTTTGGGGGG - Intergenic
948268639 2:236657021-236657043 TTTTTGGGCCTGATCCTGGGAGG + Intergenic
948455240 2:238101717-238101739 ACTCAGGTCCAGGTCTTGGGAGG - Intronic
1170095120 20:12637631-12637653 TTTTAGGCCCAGTTCCTGGTGGG + Intergenic
1171114967 20:22517581-22517603 TTTTAGGAAAAGTTCTTGGGTGG - Intergenic
1172715759 20:36962311-36962333 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1173066786 20:39721025-39721047 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1173067410 20:39726643-39726665 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1173173330 20:40744659-40744681 TGTTAGGGCCAGAGCTTGGAGGG - Intergenic
1174553495 20:51378134-51378156 TTGTTGATCAAGATCTTGGGTGG + Intergenic
1174561749 20:51435590-51435612 TGTTAGGTCCAGAGCTCTGGGGG + Intronic
1175444126 20:59008485-59008507 TTTTATGCCCAGAGGTTGGGAGG - Intergenic
1175733008 20:61366847-61366869 GTTTATGGCCAGATTTTGGGGGG + Intronic
1177377580 21:20293178-20293200 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1177419550 21:20838754-20838776 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1177519202 21:22195286-22195308 GTTTATGGCCAGATTTTGGGTGG + Intergenic
1178617436 21:34146150-34146172 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1180453013 22:15484772-15484794 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1181593721 22:23900221-23900243 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1181714630 22:24715351-24715373 TTTTTGGTTCACAACTTGGGTGG - Intergenic
949235981 3:1808384-1808406 GTTTATGGCCAGATTTTGGGGGG + Intergenic
951821934 3:26823475-26823497 GTTTATGGCCAGATTTTGGGGGG + Intergenic
953097740 3:39795270-39795292 TTTTACTTACAGATCCTGGGCGG + Intergenic
953250150 3:41238427-41238449 TTCTAGGCTCAGATCTCGGGTGG + Intronic
953359069 3:42279061-42279083 TTTTAAAACCAGATCTTGTGAGG - Intergenic
953836239 3:46347584-46347606 GTTTATGGCCAGATTTTGGGGGG + Intergenic
954003139 3:47573451-47573473 CTTTAGGGGCAGAACTTGGGGGG - Intronic
954972213 3:54660813-54660835 TTTCACGTGGAGATCTTGGGAGG - Intronic
955632261 3:60987223-60987245 GTTTATGGCCAGATTTTGGGGGG - Intronic
956943570 3:74193953-74193975 GTTTATGGCCAGATTTTGGGGGG - Intergenic
957491126 3:80928874-80928896 GTTTATGGCCAGATTTTGGGGGG - Intergenic
957906977 3:86569912-86569934 GGTTAGGTCCAGGGCTTGGGAGG - Intergenic
958614750 3:96478127-96478149 TTTTAGTCCCAGCTATTGGGGGG - Intergenic
959520998 3:107322846-107322868 TTTTGGGTCCAGATGTAGGAAGG - Intergenic
959666730 3:108931301-108931323 TTTTAGGTACAGTACATGGGTGG + Intronic
960788463 3:121399841-121399863 GTTTATGGCCAGATTTTGGGGGG + Intronic
961265409 3:125637664-125637686 GTTTAAGGCCAGATTTTGGGGGG + Intergenic
961690059 3:128662886-128662908 GTTTATGGCCAGATTTTGGGGGG + Intronic
961854010 3:129851080-129851102 GTTTATGGCCAGATTTTGGGGGG + Intronic
962149681 3:132879671-132879693 TTTCTGTTCCAGGTCTTGGGTGG - Intergenic
962850238 3:139302946-139302968 AGGTAGGTCCAGATCTGGGGAGG + Intronic
962994749 3:140614719-140614741 TTTTATTTCCAGGTCTTGTGAGG - Intergenic
963045106 3:141096335-141096357 TATAAGGTCCAGATGATGGGAGG - Intronic
963399603 3:144780802-144780824 TTTTGGGTCAAGATCATGAGAGG + Intergenic
963415129 3:144984876-144984898 GTTTATGGCCAGATTTTGGGGGG + Intergenic
963511397 3:146252440-146252462 GTTTATGGCCAGATTTTGGGGGG - Intergenic
964275366 3:155003919-155003941 GTTTATGGCCAGATTTTGGGGGG - Intergenic
966872171 3:184298274-184298296 TTTTAGCTCCAGAACTTGGCGGG + Intronic
966978186 3:185105216-185105238 GTTTATGGCCAGATTTTGGGGGG - Intronic
967179960 3:186895230-186895252 GTTTATGGCCAGATTTTGGGGGG - Intergenic
968424175 4:510519-510541 GTTTATGGCCAGATTTTGGGAGG + Intronic
968855142 4:3114370-3114392 GTTTATGGCCAGATTTTGGGGGG + Intronic
970391892 4:15620644-15620666 GTTTATGGCCAGATTTTGGGGGG - Intronic
971873456 4:32273952-32273974 GTTTATGTCCAGATTTTGGGGGG + Intergenic
972080638 4:35144712-35144734 GTTTATGGCCAGATTTTGGGGGG - Intergenic
972184193 4:36508446-36508468 TCTTTGTTCCAGATATTGGGAGG - Intergenic
972444515 4:39130516-39130538 GTTTATGGCCAGATTTTGGGGGG + Intergenic
972460625 4:39298948-39298970 GTTTATGGCCAGATTTTGGGGGG - Intronic
972533497 4:39980615-39980637 CTGTAGTCCCAGATCTTGGGAGG - Intergenic
972655439 4:41059403-41059425 GTTTATGGCCAGATTTTGGGGGG - Intronic
972694901 4:41435404-41435426 TTTAATGTCCAGATGTTGGCAGG - Intronic
973782261 4:54300018-54300040 TTTTAGCTCCAGATCCTGAGAGG + Intergenic
974535098 4:63164289-63164311 GTTTATGGCCAGATTTTGGGTGG + Intergenic
974581220 4:63804281-63804303 GTTTATGGCCAGATTTTGGGAGG + Intergenic
974978449 4:68922196-68922218 GTTTATGGCCAGATTTTGGGAGG - Intergenic
975092969 4:70424982-70425004 CTTTATGGCCAGATTTTGGGTGG - Intergenic
975575508 4:75858427-75858449 GTTTATGTCCAGATTTTGGGGGG + Intergenic
975580088 4:75898296-75898318 GTTTACGGCCAGATTTTGGGGGG + Intronic
976128516 4:81858646-81858668 GTTTATGGCCAGATTTTGGGGGG + Intronic
976179617 4:82386707-82386729 GTTTATGGCCAGATTTTGGGGGG + Intergenic
976977358 4:91181159-91181181 GTTTATGGCCAGATTTTGGGGGG + Intronic
976977984 4:91186991-91187013 GTTTATGGCCAGATTTTGGGGGG + Intronic
977358643 4:95978186-95978208 GTTTATGGCCAGATTTTGGGGGG - Intergenic
977625710 4:99187603-99187625 GTTTATGGCCAGATTTTGGGGGG + Intergenic
977851886 4:101840382-101840404 GTTTATGGCCAGATTTTGGGGGG - Intronic
977857344 4:101909709-101909731 GTTTATGCCCAGATTTTGGGGGG + Intronic
978011538 4:103691585-103691607 GTTTATGGCCAGATTTTGGGGGG - Intronic
979149070 4:117285397-117285419 GTTTATGGCCAGATTTTGGGGGG - Intergenic
979893947 4:126134635-126134657 GTTTATGGCCAGATTTTGGGAGG - Intergenic
980192630 4:129544418-129544440 TTTTAGGACAAGGGCTTGGGAGG + Intergenic
981799183 4:148636236-148636258 TTCTAGGTGAAGATATTGGGTGG + Intergenic
982519291 4:156393148-156393170 GTTTATGGCCAGATTTTGGGGGG - Intergenic
983594727 4:169453434-169453456 GTTTATGGCCAGATTTTGGGGGG - Intronic
984110755 4:175610424-175610446 CTTTATGTCCAGATTTTGGAGGG + Intergenic
984955905 4:185045272-185045294 GTTTATGGCCAGATTTTGGGGGG + Intergenic
984963985 4:185125590-185125612 GTTTATGGCCAGATTTTGGGGGG - Intergenic
985614221 5:910013-910035 GTTTATGGCCAGATTTTGGGGGG + Intronic
985625827 5:986387-986409 GTTTATGACCAGATTTTGGGGGG + Intergenic
988818370 5:34856479-34856501 ATTTGGGACCAGAACTTGGGAGG + Intronic
988968087 5:36439930-36439952 TTTCATGCCCAGATCTTGAGGGG + Intergenic
989065237 5:37453639-37453661 GTTTATGGCCAGATTTTGGGGGG + Intronic
989345520 5:40425274-40425296 GTTTATGGCCAGATTTTGGGGGG - Intergenic
989426182 5:41298392-41298414 GTTTAAGGCCAGATTTTGGGGGG + Intergenic
989474382 5:41857423-41857445 TCTGAGGTCCAGATGTTGGAGGG - Intronic
989742865 5:44793032-44793054 GTTTATGGCCAGATCTTGGGGGG - Intergenic
989758555 5:44985933-44985955 GTTTATGGCCAGATTTTGGGTGG - Intergenic
989783381 5:45297425-45297447 GTTTATGGCCAGATTTTGGGGGG + Intronic
990109872 5:52309739-52309761 TTTTGGGGCCAGATTTTGGGGGG - Intergenic
991391253 5:66145218-66145240 TTTAAAGTCCAGATCTTGGCTGG + Intronic
991570489 5:68048453-68048475 GTTTATGGCCAGATTTTGGGGGG + Intergenic
991718255 5:69472261-69472283 TTATAGGTACAGATAATGGGTGG + Intergenic
992254566 5:74908626-74908648 GTTTATGGCCAGATTTTGGGGGG + Intergenic
992466598 5:77012235-77012257 TTGTAAATCCAGCTCTTGGGAGG - Intergenic
993222044 5:85111433-85111455 GTTTATGGCCAGATTTTGGGGGG - Intergenic
994305878 5:98203741-98203763 GTTTATGGCCAGATTTTGGGGGG - Intergenic
994419051 5:99509460-99509482 GTTTATGGCCAGATTTTGGGGGG + Intergenic
994515979 5:100773470-100773492 TGTTAGGACCATATCTTGGGGGG + Intergenic
995195096 5:109358056-109358078 GTTTATGGCCAGATTTTGGGAGG - Intronic
995737318 5:115315563-115315585 TATTTGGTCCAGAACTTGGGTGG + Intergenic
995959380 5:117821433-117821455 GTTTATGGCCAGATTTTGGGGGG - Intergenic
996291896 5:121860905-121860927 GTTTATGGCCAGATTTTGGGGGG + Intergenic
997371948 5:133367573-133367595 CTTTCGCTCCAGATCTTGGTCGG + Intronic
997393388 5:133535251-133535273 GTTTATGGCCAGATTTTGGGGGG - Intronic
997948027 5:138219528-138219550 GTTTATGGCCAGATTTTGGGGGG + Intergenic
998343014 5:141434347-141434369 GTTTATGGCCAGATTTTGGGGGG - Intronic
998905736 5:146902754-146902776 GATTAGGACCAGATCTTGGGAGG - Intronic
999250025 5:150176979-150177001 TTTGTGGTCCAGGCCTTGGGGGG + Intronic
1003014448 6:2456711-2456733 TTTTAGGTTCACAACTTGAGGGG + Intergenic
1003196127 6:3916728-3916750 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1003573487 6:7271265-7271287 TTTTATATCCAGCTCTTCGGCGG - Intronic
1003761580 6:9184701-9184723 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1004061327 6:12200852-12200874 TTTTATGTCAAGAATTTGGGGGG - Intergenic
1004224787 6:13775553-13775575 TTGTAATTCCAGCTCTTGGGAGG + Intergenic
1004482847 6:16037632-16037654 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1005185483 6:23159573-23159595 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1006250009 6:32775598-32775620 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1006497092 6:34431610-34431632 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1007035257 6:38667367-38667389 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1008190705 6:48453429-48453451 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1009558495 6:65206947-65206969 TTCTTGGTCCAGTTCTTAGGGGG - Intronic
1009640731 6:66331743-66331765 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1009955640 6:70449016-70449038 TTTAATGGCCAGATTTTGGGAGG + Intronic
1010692817 6:78930807-78930829 TTGTAGTCCCAGTTCTTGGGAGG + Intronic
1010872788 6:81063019-81063041 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1011969076 6:93198667-93198689 GTTTACGGCCAGATTTTGGGGGG + Intergenic
1013475021 6:110499186-110499208 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1014644622 6:123958081-123958103 TTTCAGGGCCAGAGCTTGGGTGG - Intronic
1014880753 6:126721539-126721561 TTTTAAGTCCAGAGCTTGAATGG - Intergenic
1015805972 6:137108822-137108844 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1015839017 6:137456483-137456505 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1017140158 6:151182933-151182955 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1019233742 6:170590606-170590628 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1020337164 7:7070981-7071003 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1020531465 7:9342555-9342577 ATTTAGTCCAAGATCTTGGGAGG - Intergenic
1023009374 7:35912129-35912151 GTTTATGGCCAGATTTTGGGAGG - Intergenic
1023960688 7:44923457-44923479 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1024065190 7:45726732-45726754 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1024138412 7:46434126-46434148 GTTTACGGCCAGATTTTGGGGGG + Intergenic
1024312776 7:47984866-47984888 CTTTATGGCCAGATTTTGGGGGG - Intergenic
1024911123 7:54448852-54448874 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1025122463 7:56316950-56316972 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1025123044 7:56322282-56322304 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1025816336 7:64915724-64915746 GTTTATGGCCAGATTTTGGGGGG + Intronic
1026005080 7:66594028-66594050 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1026328316 7:69330345-69330367 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1027518095 7:79167782-79167804 GTTTATGGCCAGATTTTGGGGGG - Intronic
1028732324 7:94165892-94165914 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1030277606 7:107737138-107737160 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1030292353 7:107885210-107885232 GTTTATGACCAGATTTTGGGGGG + Intergenic
1030783321 7:113627970-113627992 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1033156624 7:138962474-138962496 TTTGAGCTCCAGATCTTAAGAGG + Intronic
1033303007 7:140202941-140202963 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1033359824 7:140630945-140630967 TTTAATGGCCAGATCTTGGCAGG + Intronic
1033878663 7:145855036-145855058 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1034538104 7:151738404-151738426 GTTTATGGCCAGATTTTGGGGGG - Intronic
1034942370 7:155238704-155238726 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1034943003 7:155244152-155244174 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1037005653 8:13776251-13776273 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1039603959 8:38865883-38865905 TTAGAGGTCCAGATTTTGTGTGG - Intergenic
1040381380 8:46876549-46876571 GTTTATGGCCAGATTTTGGGAGG - Intergenic
1040381848 8:46880779-46880801 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1040528449 8:48244992-48245014 GTTTATGGCCAGATTTTGGGAGG + Intergenic
1040782467 8:51125923-51125945 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1041493455 8:58460720-58460742 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1043685896 8:83085833-83085855 TTTTTGTCCCAGATCTTGGAAGG - Intergenic
1043695771 8:83215337-83215359 GTTTAGTTCCAGCTCTTAGGCGG - Intergenic
1044313017 8:90717161-90717183 GTTTATGGCCAGATTTTGGGGGG - Intronic
1044442250 8:92236556-92236578 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1044442873 8:92242219-92242241 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1045243642 8:100424095-100424117 TTTTAGGTAGAGAACTAGGGAGG + Intergenic
1046389811 8:113555275-113555297 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1046744379 8:117861414-117861436 ATTTAAGTCCCGATTTTGGGGGG + Intronic
1047083334 8:121489128-121489150 TTTTTGTTCCAGATCTTGGAGGG - Intergenic
1047562775 8:126007735-126007757 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1047563391 8:126013492-126013514 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1048686287 8:136908382-136908404 TTTTATGGCCAGATTTTGCGGGG + Intergenic
1048686788 8:136912816-136912838 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1048702027 8:137102151-137102173 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1048918156 8:139203773-139203795 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1049857352 8:144871064-144871086 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1053205188 9:36180217-36180239 GTTTATGGCCAGATTTTGGGCGG - Intergenic
1053539624 9:38959751-38959773 GTTTATGACCAGATTTTGGGGGG + Intergenic
1053596207 9:39564031-39564053 TTTTAGGTCCACATCTGTGGAGG + Intergenic
1053854175 9:42320672-42320694 TTTTAGGTCCACATCTGTGGAGG + Intergenic
1054570049 9:66800986-66801008 TTTTAGGTCCACATCTGTGGAGG - Intergenic
1054626517 9:67404167-67404189 GTTTATGACCAGATTTTGGGGGG - Intergenic
1055258727 9:74406326-74406348 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1056566785 9:87779760-87779782 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1056756667 9:89386038-89386060 TTTTATGCCCTGAGCTTGGGGGG - Intronic
1057286128 9:93755778-93755800 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1061602463 9:131680386-131680408 ATTTATGGCCAGATTTTGGGGGG - Intronic
1061603037 9:131685314-131685336 GTTTATGGCCAGATTTTGGGGGG - Intronic
1188116070 X:26244064-26244086 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1188894150 X:35645655-35645677 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1189670288 X:43401062-43401084 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1189978038 X:46481994-46482016 GTTTATGGCCAGATTTTGGGGGG + Intronic
1190184113 X:48219948-48219970 GTTTATGGCCAGATTTTGGGGGG - Intronic
1190614861 X:52220066-52220088 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1191848420 X:65567827-65567849 GTTTATGTCCAGATTTTGGGGGG + Intergenic
1191949148 X:66569611-66569633 GTTTAGGGCCAGATTTTTGGGGG + Intergenic
1192687821 X:73325103-73325125 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1192767661 X:74158791-74158813 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1193048960 X:77081428-77081450 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1193063187 X:77228899-77228921 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1194913280 X:99673511-99673533 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1194996521 X:100597099-100597121 TTTTAGGTTTGCATCTTGGGTGG - Intronic
1196817270 X:119675333-119675355 GTATAGGGCCATATCTTGGGGGG - Intronic
1197479238 X:126962451-126962473 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1197896869 X:131325306-131325328 TTTTAGATCCAAATCATGGCTGG - Intronic
1199008338 X:142729240-142729262 GTTTATGGCCAGATTTTGGGGGG + Intergenic
1200412286 Y:2872636-2872658 GTTTATGGCCAGATTTTGGGGGG + Intronic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic
1201700733 Y:16878837-16878859 GTTTATGGCCAGATTTTGGGGGG - Intergenic
1201893022 Y:18963205-18963227 GTTTATGGCCAGATTTTGGGGGG + Intergenic