ID: 924987163

View in Genome Browser
Species Human (GRCh38)
Location 2:282413-282435
Sequence ACACATAGTAAGTATAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 377}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924987160_924987163 7 Left 924987160 2:282383-282405 CCAGCATCTGGCAGTGCCCACAT 0: 1
1: 0
2: 1
3: 21
4: 236
Right 924987163 2:282413-282435 ACACATAGTAAGTATAAAATTGG 0: 1
1: 0
2: 0
3: 35
4: 377
924987162_924987163 -10 Left 924987162 2:282400-282422 CCACATATACAAGACACATAGTA 0: 1
1: 0
2: 2
3: 11
4: 225
Right 924987163 2:282413-282435 ACACATAGTAAGTATAAAATTGG 0: 1
1: 0
2: 0
3: 35
4: 377
924987161_924987163 -9 Left 924987161 2:282399-282421 CCCACATATACAAGACACATAGT 0: 1
1: 0
2: 2
3: 18
4: 177
Right 924987163 2:282413-282435 ACACATAGTAAGTATAAAATTGG 0: 1
1: 0
2: 0
3: 35
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924987163 Original CRISPR ACACATAGTAAGTATAAAAT TGG Intronic
901755610 1:11439825-11439847 TCACATAGGCAGTAGAAAATGGG - Intergenic
902348091 1:15833950-15833972 ATACATAGTAAGAATATAAAGGG + Intergenic
903732348 1:25505756-25505778 ACACATAGTAACCACAAATTGGG - Intergenic
904298058 1:29536180-29536202 ACACATTTAAGGTATAAAATTGG - Intergenic
905906603 1:41622540-41622562 ACAGATAATATGTAAAAAATGGG - Intronic
906080350 1:43083280-43083302 AAAAATAGTAAGTGTAAAAATGG - Intergenic
906801408 1:48740399-48740421 ACCCATACTATGTATAAATTAGG + Intronic
908524381 1:64973853-64973875 ACAGAAAGTAAGAAAAAAATCGG + Intergenic
908626731 1:66053018-66053040 CCACATAGAAAGACTAAAATGGG - Intronic
908686573 1:66726730-66726752 ATACATTGTAAGACTAAAATAGG + Intronic
909111834 1:71488931-71488953 ACAGATAGTAAGTAAAATAGTGG - Intronic
909315516 1:74212841-74212863 ACACATAGCAAATATGAAAAAGG - Intronic
910048300 1:82944466-82944488 TCACATAGTGTTTATAAAATGGG - Intergenic
910251705 1:85204742-85204764 ACACATAGTTAGTAATAGATGGG - Intergenic
910571541 1:88710340-88710362 CAATATATTAAGTATAAAATAGG - Intronic
911425004 1:97697812-97697834 ATACATAGTAAGTTACAAATAGG + Intronic
911568028 1:99487454-99487476 AAATTTAGTAAGGATAAAATGGG + Intergenic
911909145 1:103610227-103610249 AAAAATAGTAAGTATAACACAGG - Intergenic
911913774 1:103669234-103669256 AAAAATAGTAAGTATAACACAGG + Intronic
912747056 1:112253665-112253687 GCACATAGTAAATATCAAAGAGG - Intergenic
915035978 1:152925465-152925487 ACACATAGGAAGGACAACATTGG + Intergenic
915115608 1:153597251-153597273 ACACAGAGTTAGTAAAAGATGGG + Intergenic
915846109 1:159266857-159266879 ACAGATAGTAAGTATTAGAGAGG - Intergenic
916439338 1:164807482-164807504 ACACCAAATAAATATAAAATGGG - Intronic
917188599 1:172389334-172389356 ACACATAGAAATTTTAATATAGG + Intronic
917449086 1:175131819-175131841 ACAACTAGTAAGTATAGAACTGG + Intronic
918213196 1:182370011-182370033 ACACATAATAATAATAAAATGGG + Intergenic
919144859 1:193621291-193621313 ACCCATTTTAAGTATACAATTGG - Intergenic
920276577 1:204810087-204810109 ACAAATAGAAAGTAGAAAAGTGG - Intergenic
922392102 1:225155344-225155366 ACATGTAATAAGTATAAAAAGGG + Intronic
923114359 1:230921013-230921035 TCACCAAGTAAATATAAAATCGG - Intronic
924489064 1:244517130-244517152 ACACATAGAAATTATCAAAAAGG - Intronic
1063760444 10:9068655-9068677 ACACATAATATGCATAAAAGTGG - Intergenic
1064780668 10:18834779-18834801 TCACATAGTAAGTCTTATATTGG + Intergenic
1065671245 10:28120471-28120493 AAACATAGTAATTTTAAAACTGG + Intronic
1065680838 10:28230230-28230252 ACAAAGAGAAAGCATAAAATGGG + Intronic
1065947594 10:30620639-30620661 ACACATACTAAGAAAAAGATCGG + Intronic
1067401203 10:45975303-45975325 ACAGATAGGGAGGATAAAATGGG + Intronic
1067869556 10:49944881-49944903 ACAGATAGGGAGGATAAAATGGG + Intronic
1067982917 10:51107421-51107443 ACCCATAGTAAGTAAAAGAAAGG + Intronic
1068364011 10:56020378-56020400 TTACATAGTAAGTGTAATATTGG + Intergenic
1068905272 10:62315223-62315245 ACACACTGAAAATATAAAATTGG + Intergenic
1069653926 10:70073533-70073555 CGACATATGAAGTATAAAATAGG + Intronic
1069726152 10:70580875-70580897 AGACTTAGAAAGTATAAAAATGG - Intergenic
1072145257 10:92630388-92630410 ACTCATATTAAGTAGAGAATGGG + Intronic
1072557909 10:96538358-96538380 ACTCATACTATATATAAAATTGG + Intronic
1073922411 10:108474101-108474123 ACACATAGTAAGTAGAGAGCTGG - Intergenic
1073946378 10:108755405-108755427 ACACACAGTAAGTCTAAAAAGGG + Intergenic
1075891126 10:125952107-125952129 ACAAATAGTAAGTACAACTTGGG - Intronic
1078055633 11:8006801-8006823 ACACATAGTATTTCTAAACTTGG + Intergenic
1080176026 11:29364299-29364321 ACTTAAAGTAAGAATAAAATTGG - Intergenic
1080821007 11:35806548-35806570 GCACACAGTAAGCATAAAACTGG - Exonic
1081227751 11:40545632-40545654 GCACATATTAAGTATAAACAAGG + Intronic
1081506301 11:43720732-43720754 GCACCTAGTAAGTTTAAACTTGG + Intronic
1082251775 11:49990325-49990347 ACAGATAGAAATTATAAAAAAGG - Intergenic
1082663038 11:55938133-55938155 ACACATAGTAAGCATTATACAGG - Intergenic
1085191876 11:74633384-74633406 ACACACTTTAAGTATAAAATGGG - Intronic
1085932654 11:81103359-81103381 ACCCATAGTAAATATATACTTGG - Intergenic
1086540992 11:87912727-87912749 ACCCAAAGTAAGTAGAAAAAAGG - Intergenic
1087292576 11:96336133-96336155 ACAGCTAGTAAGTATAACATAGG + Intronic
1088067222 11:105734177-105734199 AAACTAAGTATGTATAAAATTGG + Intronic
1088098498 11:106128318-106128340 ACACATAGTAGGCAAAAAACAGG - Intergenic
1089049043 11:115530090-115530112 ACAAATAATACATATAAAATTGG - Intergenic
1089314590 11:117582955-117582977 CCACATTGTGAGAATAAAATGGG - Intronic
1089361043 11:117886860-117886882 GCACATAGTAGGTACATAATAGG - Intergenic
1089936458 11:122369482-122369504 ACATAAGGTAAGTATAAAATAGG + Intergenic
1091251662 11:134149066-134149088 ACACGGAGTAAGTCTAACATGGG - Intronic
1093151095 12:15622556-15622578 GCACATTTTAAGTCTAAAATAGG + Intronic
1093354524 12:18149956-18149978 ACACATAGTACATATAGAAAGGG + Intronic
1093395726 12:18679777-18679799 ACACATGGAAAGTAGAAAAAGGG + Intergenic
1093411649 12:18875629-18875651 AAATATAGAAAATATAAAATTGG + Intergenic
1093528613 12:20135071-20135093 ACAAATAGCCAGTATAAAAAAGG - Intergenic
1093678425 12:21971393-21971415 ACACATACTAGGTATTAAATTGG + Intergenic
1093833702 12:23799475-23799497 ACCCATAGTGACTATAAAATGGG + Intronic
1094049255 12:26200949-26200971 TCTCATAGTAAGTATAAAAATGG + Intronic
1094150296 12:27275273-27275295 ACACAAAGTAAGTATGATAATGG - Intronic
1094727527 12:33135578-33135600 ATACATATTAACTTTAAAATGGG + Intergenic
1096641360 12:52997006-52997028 ACCCATTGAAAGTATACAATTGG + Intergenic
1097975341 12:65679975-65679997 GCACATAGTAAGTACTTAATAGG - Intergenic
1097975633 12:65683694-65683716 ACATTTATTAAGTATAAAATTGG - Intergenic
1098508996 12:71289859-71289881 ACAAATAGAAATTATAAAAAAGG - Intronic
1098701218 12:73629601-73629623 AAACATAGTTTTTATAAAATAGG + Intergenic
1099367543 12:81787124-81787146 ACACATATTAAGAATAAAGATGG - Intergenic
1100104537 12:91153531-91153553 AAAGATAGTAATTATAAAGTGGG + Intronic
1101350098 12:103921919-103921941 ACACATTTTAAGTTAAAAATGGG - Intergenic
1101351330 12:103931905-103931927 ACACCGAGTAAGTTTAAAAATGG + Intronic
1106623602 13:31395784-31395806 ACAGATAATAGGTATAAAAGAGG - Intergenic
1106861578 13:33914851-33914873 GCAAAGAATAAGTATAAAATAGG + Intronic
1107426934 13:40303475-40303497 ACACCTAGAAGGTATGAAATGGG - Intergenic
1107795967 13:44052118-44052140 ACACATACTATGTATACAGTTGG - Intergenic
1107934254 13:45331534-45331556 ACAGATGGCAAGGATAAAATTGG - Intergenic
1108398824 13:50018170-50018192 ACACAAAGAAAGGACAAAATAGG - Intronic
1108748480 13:53420687-53420709 ACACATAGGAAGCACTAAATTGG - Intergenic
1109535268 13:63708756-63708778 ATATTTAGTAATTATAAAATTGG + Intergenic
1109896596 13:68699818-68699840 AAAAATAGGAAGTATAAACTTGG - Intergenic
1110325050 13:74204141-74204163 ACACATAGTAAATAAAAAACTGG - Intergenic
1110674214 13:78220683-78220705 ACAGATAATAAGTATCAATTTGG - Intergenic
1110831868 13:80041189-80041211 AAACAAAGTAAATATAAATTAGG + Intergenic
1110929611 13:81198558-81198580 ACACATAGAAAATAAGAAATTGG - Intergenic
1110947582 13:81442575-81442597 ACATAGAGTAACTATAGAATAGG + Intergenic
1111167719 13:84483816-84483838 ACAGATAGTAAGTACTAAATTGG - Intergenic
1111280006 13:86010166-86010188 ACCCATATTTAGTATAAAAATGG + Intergenic
1112352016 13:98643346-98643368 ACACAGAGGAAATAAAAAATTGG - Intergenic
1112694427 13:101931812-101931834 ACATGTAGGAAGTTTAAAATGGG - Intronic
1112897644 13:104320321-104320343 ACACATTGTAAACTTAAAATGGG + Intergenic
1114058017 14:18991746-18991768 ACACATACTCAGCATGAAATGGG - Intronic
1115021804 14:28690155-28690177 TCAAAAAGTAACTATAAAATTGG - Intergenic
1115699941 14:35943218-35943240 ACAAAAAGTAAAAATAAAATAGG + Intergenic
1116510542 14:45740627-45740649 AACCATAATAAGCATAAAATGGG - Intergenic
1117017142 14:51529625-51529647 GCAAGTAGTAAATATAAAATTGG + Intronic
1117133856 14:52713432-52713454 ACACAAAATAATTCTAAAATGGG - Intronic
1117740807 14:58817216-58817238 ACACAGATGAAGTCTAAAATTGG + Intergenic
1117792976 14:59360738-59360760 ACACATATTAAATATAAGATGGG - Intronic
1118508740 14:66446054-66446076 ATACAAAGTAAGAATAAAATAGG - Intergenic
1119445469 14:74659737-74659759 AGACACAGTATGTATAAAAAAGG - Intronic
1119501314 14:75130076-75130098 ACATATAGTTAATATAAAAATGG - Intergenic
1120431548 14:84423418-84423440 ATCCATAGTAAGTAAAAAGTAGG + Intergenic
1120918583 14:89732608-89732630 CCACATTGTAAGAATAAATTTGG - Intergenic
1122511338 14:102270758-102270780 ACAACTAATAAGAATAAAATAGG - Intronic
1123178947 14:106449210-106449232 ACACAAATTAATTTTAAAATGGG - Intergenic
1124581600 15:30960505-30960527 ACAAATAGTAGGTAAAAAAGAGG + Intronic
1124882780 15:33657617-33657639 GCACAAAGCAAGTATATAATAGG + Intronic
1126125160 15:45289061-45289083 ACACATAATAAAGAAAAAATTGG - Intergenic
1126812760 15:52424714-52424736 ACACATTATAAATATAATATGGG - Intronic
1127091881 15:55475271-55475293 ACAAATATTAAGGATAAAACTGG + Intronic
1128903656 15:71448576-71448598 ATACATAGTAGGTATATTATGGG + Intronic
1130176163 15:81573734-81573756 ATAGATAGTAAGTATAGACTGGG - Intergenic
1131036887 15:89228394-89228416 GCACAAAATAATTATAAAATAGG + Intergenic
1133439736 16:5810901-5810923 ACACATATGAAGAGTAAAATTGG + Intergenic
1136600582 16:31284601-31284623 ACAGAGAGTAAGTGGAAAATTGG - Intronic
1137327536 16:47456835-47456857 CCACATAGTAAGTCTACAAAAGG + Intronic
1140505437 16:75469033-75469055 AAAAATAGGAAGTATAAAAAGGG + Intergenic
1140512800 16:75520195-75520217 AAAAATAGGAAGTATAAAAAAGG + Intergenic
1141014006 16:80430714-80430736 ACACTTAGAAATTAGAAAATAGG - Intergenic
1141055391 16:80809047-80809069 ACTCATATTAAGTTTGAAATGGG - Intergenic
1143814810 17:9504065-9504087 ACACATACTAAGTTTTAAAAAGG + Intronic
1149875933 17:60233144-60233166 GTACATAGTAAGTACTAAATAGG - Intronic
1150449902 17:65258079-65258101 ACACCTAGTAAGTATTAACATGG + Intergenic
1150513080 17:65776531-65776553 TCACATACTAACTATAAAAAGGG - Intronic
1152490219 17:80626358-80626380 ACAAATATAAAGTAGAAAATTGG - Intronic
1153476075 18:5499804-5499826 ACACATAGTAAGTATGTAGTAGG - Intronic
1153886557 18:9473280-9473302 ACACAAAACCAGTATAAAATTGG - Intergenic
1154223689 18:12480825-12480847 AAATTTAGTAACTATAAAATCGG + Intronic
1157117425 18:44875217-44875239 ACACTTAGAAAGAGTAAAATTGG + Intronic
1157434005 18:47653324-47653346 ACACATAGTAATTATTGGATGGG - Intergenic
1158087026 18:53663141-53663163 ATACATAGGAAGTTTAATATTGG - Intergenic
1159116454 18:64118720-64118742 ATAGATAATAAGTATAAAATGGG - Intergenic
1159244149 18:65782922-65782944 ACAAACAGAAAGTACAAAATAGG + Intronic
1159484435 18:69036456-69036478 ACACAAAGTAAATATTGAATTGG + Intronic
1165260101 19:34606736-34606758 ACAGGTACTAATTATAAAATAGG - Intronic
1166307277 19:41941773-41941795 ACACATACAAACTAGAAAATGGG + Intergenic
1202672530 1_KI270710v1_random:4440-4462 ACACTGCGTAAGTATAAAACAGG - Intergenic
924987163 2:282413-282435 ACACATAGTAAGTATAAAATTGG + Intronic
925161949 2:1691271-1691293 ACACATACTTGCTATAAAATTGG - Intronic
925659529 2:6187629-6187651 ACATATATTAAATATATAATAGG - Intergenic
926188999 2:10713255-10713277 ACATATTGTAAGTATATATTAGG - Intergenic
927388512 2:22564789-22564811 ACACTTACTAAGTATATCATGGG - Intergenic
927778337 2:25919436-25919458 ACAAATAGTAACTGTATAATAGG + Intergenic
929088157 2:38189093-38189115 ACAGAAAGGAAGTATAAAATTGG - Intergenic
930252440 2:49049975-49049997 ACACCTAGCAAGTTAAAAATAGG + Intronic
930812089 2:55553298-55553320 ACACCTTGTAAGTATAAGAATGG - Intronic
931627403 2:64269155-64269177 ACACACAGTAAGTACTTAATAGG + Intergenic
931849135 2:66235338-66235360 ACACATAGAGTGAATAAAATAGG + Intergenic
932584385 2:73016837-73016859 ACATATCGTAAGTTGAAAATGGG + Intronic
932718308 2:74119766-74119788 AAATATAGGAATTATAAAATTGG - Intergenic
934894861 2:98107715-98107737 ACAGATATCAAGAATAAAATGGG - Intronic
935536806 2:104304190-104304212 ACACACAGTAAGCATACCATTGG + Intergenic
935876799 2:107515976-107515998 ACACATATTTAGTGTAACATTGG + Intergenic
936725454 2:115309613-115309635 ACACATAGTAAGTCTGTAAGTGG - Intronic
938113246 2:128584242-128584264 ACCCAAAGTAAGTAGAAAAAAGG - Intergenic
938222151 2:129579065-129579087 AGAAAGAGTAAGAATAAAATTGG - Intergenic
938737412 2:134198893-134198915 ACACTCAGCAAGTATAAAAGAGG + Intronic
938950612 2:136251225-136251247 ACACCATGCAAGTATAAAATAGG - Intergenic
939097339 2:137849006-137849028 AGAAAAAATAAGTATAAAATAGG + Intergenic
939258828 2:139780671-139780693 ATAGATAATAATTATAAAATTGG + Intergenic
939383801 2:141470036-141470058 AAACATAGTCTGTATAAGATTGG + Intronic
939522296 2:143246345-143246367 ACACAGACTAAGTATGAAAGTGG + Intronic
939589750 2:144049922-144049944 GCACATAGTAAGTTTATAATTGG + Intronic
940702702 2:157065740-157065762 ATATAAAATAAGTATAAAATAGG + Intergenic
941269856 2:163411676-163411698 ACACAGAGTCATAATAAAATGGG + Intergenic
941417248 2:165236134-165236156 ACAAATATTAGGTATAAACTAGG + Intergenic
941502129 2:166292494-166292516 AAATAAAGTAAATATAAAATAGG + Intronic
942256413 2:174104101-174104123 ACACAGTGTAATTATATAATGGG + Intronic
944725983 2:202471408-202471430 AAAGTTAGTAATTATAAAATGGG + Intronic
945238112 2:207651719-207651741 ACACAAAGGAAATATAAATTAGG - Intergenic
945662459 2:212703044-212703066 GCACATAGAAAATATAAACTTGG + Intergenic
946477226 2:220018793-220018815 ACAGGTAATAAGTATAAAAATGG + Intergenic
947215414 2:227745517-227745539 ACACATTGTAAGTATTCAATAGG - Intergenic
948021713 2:234738693-234738715 ACACTGAGTGAGTATCAAATGGG - Intergenic
948090447 2:235289336-235289358 ACACATATTACATATAAAAGTGG + Intergenic
948117641 2:235505462-235505484 AAACAAAGTGAGTATAAACTTGG - Intronic
1171061285 20:21963691-21963713 ACACATAATAAGAATAACAAAGG - Intergenic
1171433586 20:25102854-25102876 ACACATAGGAGGTAGAAAAGAGG - Intergenic
1171859332 20:30381155-30381177 ACTAATAGTAAGTACAAAGTTGG - Intronic
1171952262 20:31430971-31430993 AAACTTAGTAAGCAGAAAATGGG - Intergenic
1171998919 20:31756246-31756268 TTACATAGTTAATATAAAATTGG + Intronic
1172081493 20:32344605-32344627 GCATATAGTAGGTATTAAATAGG - Intergenic
1173418039 20:42875965-42875987 ACACATAGTAAGCACTACATAGG + Intronic
1174055400 20:47794906-47794928 ACACATAGTAAGGCTAACACAGG + Intergenic
1174266565 20:49336243-49336265 ACACATACTAATTATAATACTGG + Intergenic
1174310987 20:49654250-49654272 ACACATAGTACATATAATCTTGG - Intronic
1175052463 20:56167968-56167990 AGCCATCTTAAGTATAAAATGGG + Intergenic
1176274839 20:64258876-64258898 ACATGGGGTAAGTATAAAATTGG + Intronic
1177205173 21:18001853-18001875 AAAGTTAGTAAATATAAAATAGG + Intronic
1177724780 21:24953189-24953211 AAACATAGTAAGTATGTATTAGG + Intergenic
1178110788 21:29368134-29368156 ACACATAATTAGTGTAAATTAGG + Intronic
1180297579 22:10957463-10957485 ACTAATAGTAAGTACAAAGTTGG + Intergenic
1180410850 22:12606326-12606348 ACTAATAGTAAGTACAAAGTTGG - Intergenic
1181293504 22:21816522-21816544 ACACATTTAAAGTATAAAGTTGG - Intronic
1182401666 22:30082449-30082471 ACACATAGTAGGGGTAAAATAGG + Intronic
1182930222 22:34166601-34166623 GCAAATTTTAAGTATAAAATCGG + Intergenic
1183076206 22:35428767-35428789 ACAACTAGTAAGTATGAAATAGG - Intergenic
949436223 3:4032401-4032423 TCACAGGGTAAGTATTAAATAGG + Intronic
949545838 3:5071553-5071575 ACAAATACTGAGTATAAAATGGG - Intergenic
949606673 3:5660970-5660992 ACTCCTAGTAAATATAAAACAGG + Intergenic
949630211 3:5918204-5918226 ATTGATAGTAAGAATAAAATAGG - Intergenic
949729674 3:7093803-7093825 CTACATAGTAAGTATTCAATAGG - Intronic
950794913 3:15502998-15503020 CCACATAGCAAGTACAGAATTGG + Intronic
951109517 3:18785541-18785563 TCACATAGACAGTTTAAAATAGG - Intergenic
951313002 3:21152403-21152425 ATACACAGTAAGTATAAAGCAGG - Intergenic
951568827 3:24040664-24040686 CCACATAGTTAGTATGAATTTGG + Intergenic
953163518 3:40443796-40443818 ATACATGGAAAGTATAAATTGGG - Intergenic
954229917 3:49208904-49208926 CTTCATAGAAAGTATAAAATTGG + Intronic
956426530 3:69141289-69141311 ACACATAGAAACTATCAAACAGG - Intergenic
957341338 3:78901448-78901470 AAATATAGTAAATATAAAAGAGG + Intronic
957471255 3:80659798-80659820 ACACAAAGAAAGGAGAAAATAGG + Intergenic
957533362 3:81468898-81468920 ATACATTGTTAGTATATAATTGG - Intergenic
958042386 3:88242902-88242924 GAACCTAGTAAGTATGAAATAGG + Intergenic
958510582 3:95041878-95041900 TCAAATATTAAGTATAAAACAGG - Intergenic
958699740 3:97572746-97572768 GCACATAGTAGGCATACAATGGG - Intronic
958870642 3:99555043-99555065 ACAAATAATAAGTGTAAAAATGG + Intergenic
959150433 3:102600810-102600832 ACACATGGTGTGTATACAATTGG + Intergenic
959254735 3:103993647-103993669 GCACAAAGTATATATAAAATAGG - Intergenic
960078681 3:113516729-113516751 GCACTTAGTAAGTGTAAAGTAGG - Intergenic
960104891 3:113785138-113785160 TCACATAGTAATTATATAATGGG + Intronic
961210926 3:125125199-125125221 CCAAATAGTAATTATAAAATGGG - Intronic
961243529 3:125432613-125432635 ACCCATATTTAGTATAAAAATGG + Intergenic
961496497 3:127296112-127296134 ACATATGGTTAGTATAAATTGGG - Intergenic
961908738 3:130291161-130291183 ACAAATAATAAGTAGAAGATGGG - Intergenic
962103479 3:132366675-132366697 AAACATATCAAGTATACAATTGG + Intronic
964223565 3:154371743-154371765 ACAAATAGAAAGTAGAAAAAAGG + Intronic
964662919 3:159140603-159140625 ACACAGAGGCAGGATAAAATAGG + Intronic
964888327 3:161510117-161510139 GCACATAGTAAGTGCAAGATAGG + Intergenic
965191427 3:165534572-165534594 AGAAATAATAAGAATAAAATTGG + Intergenic
965277613 3:166705774-166705796 AGAAATAGAAAGTAGAAAATAGG + Intergenic
965503888 3:169489858-169489880 AAACATATAAAGTATAAAACGGG + Intronic
965980960 3:174689733-174689755 GCACATAGTAGGTATTCAATTGG + Intronic
965981270 3:174694223-174694245 CCACATAGAGAGAATAAAATTGG + Intronic
965999797 3:174934008-174934030 ATACATATTAAGGATGAAATAGG + Intronic
966003427 3:174978588-174978610 ACATATAGTAAGTATTAAAAGGG - Intronic
966265892 3:178042881-178042903 ACACCTAGTATGTATATACTGGG - Intergenic
966643545 3:182217073-182217095 AAACACAGCAAGTCTAAAATAGG + Intergenic
969245696 4:5931308-5931330 ACACCTAGTAAGTATCAGTTAGG + Intronic
969802668 4:9581696-9581718 ACCCATCGTCAGAATAAAATAGG + Intergenic
969936912 4:10691217-10691239 ATACATAATATGTATAATATGGG + Intergenic
970213355 4:13733322-13733344 GCATATAGTAAGAACAAAATTGG - Intergenic
970966329 4:21932419-21932441 ACAAATAGCAAGTATCACATAGG - Intronic
971595876 4:28527765-28527787 ACTTAAAATAAGTATAAAATGGG + Intergenic
971680109 4:29688125-29688147 ACACAAATTATGTACAAAATCGG + Intergenic
971836424 4:31769173-31769195 AAACATACTAAGTTTAAAATAGG - Intergenic
971927843 4:33037511-33037533 TCTCATAGTAAATATCAAATAGG + Intergenic
973073368 4:45893780-45893802 AGATATAGTAAGTTCAAAATAGG + Intergenic
973086741 4:46072854-46072876 AGGCAAAGTAAGTTTAAAATAGG - Intronic
973825812 4:54705958-54705980 ACACATAGTAAGCACATAAATGG + Intronic
974110250 4:57517162-57517184 ACATATAGTAGCTATAGAATAGG + Intergenic
975192320 4:71479490-71479512 ACACATATTGACTATAATATGGG - Intronic
975575651 4:75860046-75860068 ATAAATAAAAAGTATAAAATAGG + Exonic
976479209 4:85520135-85520157 ACAAATAGTGTGTATAAAAGAGG + Intronic
976533062 4:86178290-86178312 ACACACAGTAAGTATTCAATAGG + Intronic
977258353 4:94765681-94765703 TCACATAGTAAATGAAAAATTGG + Intronic
977966105 4:103150279-103150301 ACACATATTAAGAAAAAAACAGG + Intronic
978094532 4:104759630-104759652 ACACATAGAAAATGTAATATTGG + Intergenic
978097621 4:104797279-104797301 ACAAAAAGTAAGCATAAAAAAGG - Intergenic
978489053 4:109291268-109291290 TCACATAGAAAGTATAAATCTGG - Intronic
979571427 4:122230773-122230795 GCACATATTAAATATACAATGGG - Intronic
979710893 4:123778281-123778303 ACACGTAGTCAATCTAAAATGGG - Intergenic
981227726 4:142316429-142316451 ATACATAGTATGTATAAATATGG + Intronic
981811272 4:148778140-148778162 ATACATAATATGGATAAAATTGG + Intergenic
983289053 4:165778151-165778173 ACACATAGTAATTATAGATGTGG + Intergenic
983755699 4:171332108-171332130 ACACAGAGTAAGTAGTAAGTTGG + Intergenic
985259543 4:188102440-188102462 AAAGATAGTAAGTAGGAAATTGG + Intronic
985811515 5:2093389-2093411 ACACATTTAAAATATAAAATTGG - Intergenic
986486731 5:8245495-8245517 ACGCCTAGTTAGCATAAAATAGG + Intergenic
986893442 5:12337283-12337305 AAACATTATAATTATAAAATTGG + Intergenic
987832653 5:23116303-23116325 ACAAATAGTAAGCACTAAATAGG + Intergenic
988297233 5:29381042-29381064 ACACATACTAGCTATAAAATAGG + Intergenic
988316489 5:29636431-29636453 ACACATCAGAAGTATAATATTGG - Intergenic
989118842 5:37983223-37983245 ACACATACTAAGTAGAAGAATGG + Intergenic
989292085 5:39779914-39779936 TCACAAAAAAAGTATAAAATTGG + Intergenic
990045883 5:51430915-51430937 AAAGATAGTAGGTATAAAAAAGG + Intergenic
990085346 5:51969695-51969717 ATATATAGTCAATATAAAATGGG - Intergenic
990146301 5:52764327-52764349 ACACATAGTGATTAGAAAAGTGG - Intergenic
991291848 5:65040971-65040993 AGACACAGTAAGAAGAAAATAGG + Intergenic
991576709 5:68112044-68112066 TCACATAATAATTATAGAATTGG + Intergenic
993156470 5:84230934-84230956 ACACATAGACATTATAAAAGAGG + Intronic
993253919 5:85562978-85563000 TCACATAGTAAGTATTACATTGG - Intergenic
994419813 5:99518012-99518034 AGAAATAGTCAGTATAAATTTGG + Intergenic
995999786 5:118345798-118345820 ACACACACTAAGTATGAAATAGG - Intergenic
996146102 5:119978925-119978947 AAACACAGAAAGGATAAAATCGG - Intergenic
996537042 5:124588561-124588583 ACATATATTAAGCAGAAAATAGG + Intergenic
997075901 5:130676630-130676652 GAATATTGTAAGTATAAAATAGG + Intergenic
997406266 5:133649683-133649705 ACACATTATAATTAAAAAATGGG - Intergenic
998240130 5:140433750-140433772 ACATATAATATTTATAAAATAGG + Intronic
998553389 5:143099613-143099635 ACACAGAGTGAGTATACAAGAGG - Intronic
998755042 5:145368537-145368559 AGACATACTAAGTATATATTAGG - Intergenic
998847641 5:146326408-146326430 ACAGACAGTAAGGATAAAATGGG + Intronic
999987867 5:157021991-157022013 ACACCTACTAAGTATAAGCTAGG + Intergenic
1000951865 5:167493860-167493882 ACACATAAACAATATAAAATAGG + Intronic
1003662020 6:8071271-8071293 ACAAATAGAAATTATAGAATGGG - Intronic
1003992702 6:11502392-11502414 ACTCATAGTAAGTAAAAGAAAGG - Intergenic
1004684660 6:17931410-17931432 ACACATGGTAAGTGTTCAATAGG - Intronic
1004762622 6:18686575-18686597 AGAAATAGTAAATATAAAAGTGG - Intergenic
1005783333 6:29216937-29216959 AAACATAATAGGTATATAATAGG - Intergenic
1007302082 6:40875159-40875181 ACAGAGAGAAATTATAAAATAGG - Intergenic
1008203775 6:48627168-48627190 ATACAAAGTAAGAATAACATTGG + Intergenic
1008300022 6:49825410-49825432 ACATATTGTAAGTTTTAAATGGG + Intergenic
1009277799 6:61706021-61706043 ACACATAGTAAATGGAATATTGG + Intronic
1010567032 6:77428693-77428715 ACACAGAGAAAGTAAAAAAGTGG - Intergenic
1010615186 6:78004227-78004249 ATACATAATAAATATAAAATAGG - Intergenic
1010640484 6:78320389-78320411 ATACACAGTAAGTGTAAAGTAGG - Intergenic
1010852175 6:80790764-80790786 ACATATATTAACTATAAAAGTGG - Intergenic
1011833085 6:91397193-91397215 ACACATAGTAGGTCTAAACCAGG - Intergenic
1013569352 6:111405864-111405886 AAATATAGTTAGTATCAAATTGG - Intronic
1014923499 6:127241717-127241739 ACAAAAAGTAAGTAGAAAAAGGG + Intergenic
1015450337 6:133360240-133360262 ATACATACTTAGTATCAAATAGG + Intronic
1017156458 6:151326431-151326453 AGCCATAGTTATTATAAAATCGG + Intronic
1017543255 6:155424541-155424563 ACACATAGTAAAGCTCAAATGGG - Intronic
1017680247 6:156856635-156856657 ACACACAGGATGTATTAAATGGG - Intronic
1018400880 6:163417793-163417815 GCATATAGTATGTTTAAAATGGG + Intronic
1018470477 6:164092221-164092243 AAACATAGTGTGTATATAATCGG + Intergenic
1018978679 6:168584702-168584724 GCTCCTAGTAAGCATAAAATAGG - Intronic
1019884248 7:3890296-3890318 ACACATAGCACGTATCAATTTGG - Intronic
1021234320 7:18123803-18123825 TCACATAATAAGTCTAAAACAGG + Intronic
1021270382 7:18577579-18577601 ACATAAAGTACATATAAAATGGG - Intronic
1022162545 7:27726236-27726258 TCACATAGTAAGTATTCAGTCGG - Intergenic
1022197906 7:28086967-28086989 ACACATAGTAAGTTAAATAAAGG - Intronic
1022208561 7:28186152-28186174 ACATATAGTATGTATATTATAGG + Intergenic
1022882847 7:34606888-34606910 TCACAAAGCAAGTAGAAAATGGG - Intergenic
1025090786 7:56062289-56062311 ACACAAATTAAGTACAAAGTAGG + Intronic
1025833256 7:65073040-65073062 ACACAAATTAAGTACAAAGTAGG + Intergenic
1025903018 7:65762546-65762568 ACACAAATTAAGTACAAAGTAGG + Intergenic
1025985320 7:66445718-66445740 AGAAATGGTAACTATAAAATGGG - Intergenic
1026002191 7:66569325-66569347 AGAAATGGTAACTATAAAATGGG - Intergenic
1027024111 7:74838264-74838286 ACACATAGAAAGGGTATAATGGG + Intronic
1027063820 7:75107057-75107079 ACACATAGAAAGGATATAATGGG - Intronic
1027208536 7:76124326-76124348 AGAAATGGTAACTATAAAATGGG - Intergenic
1028135813 7:87221883-87221905 ACAAATAGTAAGTATCCAAATGG + Intergenic
1028659490 7:93253047-93253069 AAACATAGATACTATAAAATAGG - Intronic
1028820265 7:95201572-95201594 ACAGAGAGTAAATAGAAAATAGG - Intronic
1030894319 7:115038518-115038540 AGTCATAGAAAGTATGAAATGGG + Intergenic
1031059186 7:117030308-117030330 ACATATAGTAAATGTAAAAGTGG + Intronic
1031320412 7:120319347-120319369 ACAAATATCAAGTAAAAAATGGG + Intronic
1031384179 7:121126265-121126287 ATACATATTTAGTTTAAAATTGG + Intronic
1031644648 7:124209360-124209382 ACACCTAGTAAGTAGTAAATAGG + Intergenic
1031760426 7:125706905-125706927 ACACTAAGTAAGAATATAATAGG - Intergenic
1031861765 7:126987921-126987943 ACACATGCTAATTTTAAAATTGG - Intronic
1032147011 7:129393108-129393130 AAACATATTAATTATAAACTGGG - Intronic
1034545889 7:151789052-151789074 CCTTATAGTAAGTTTAAAATTGG + Intronic
1034789480 7:153955360-153955382 ACACATATAAAGCACAAAATAGG - Intronic
1039812157 8:41058802-41058824 AAAGATTGGAAGTATAAAATGGG + Intergenic
1041045793 8:53884721-53884743 ACAGATAGAAAGTATAAATAAGG + Intronic
1041465782 8:58156280-58156302 ACACATTGAAAGGCTAAAATGGG - Intronic
1041979076 8:63834714-63834736 ACAAAAAATAAGTTTAAAATAGG - Intergenic
1043751276 8:83938486-83938508 ATACAAAGTAACTATAGAATGGG - Intergenic
1043966257 8:86480950-86480972 TCACATAGTAAATATAAATTAGG - Intronic
1044108273 8:88238719-88238741 ACACATATGCAGTATAAAAAAGG - Intronic
1044856770 8:96484334-96484356 ACACAATGTAAGTAAATAATGGG + Intergenic
1045029215 8:98118799-98118821 ACACATAACAATTAGAAAATAGG - Intronic
1045609171 8:103814973-103814995 TCACATATTAAGTATAATGTTGG - Intronic
1046279963 8:112014845-112014867 ACAAATATTAAGAATAAAAAAGG + Intergenic
1047163262 8:122406078-122406100 ACACTTAGTAAGTATTACGTTGG - Intergenic
1047378425 8:124329040-124329062 GTACATAATAGGTATAAAATAGG + Intronic
1047668621 8:127120233-127120255 GCACATAGAAATAATAAAATGGG + Intergenic
1048251571 8:132870531-132870553 GCACATAGTAGGTATTCAATAGG + Intronic
1048644971 8:136409869-136409891 ACACAAAGTAAGTATTCAATAGG + Intergenic
1050293000 9:4176232-4176254 ACACATACAATGTAAAAAATTGG + Intronic
1050955231 9:11648847-11648869 ACATATGGAAAGGATAAAATAGG - Intergenic
1051002433 9:12300794-12300816 AGACATACTAATTATAATATAGG - Intergenic
1051930136 9:22375183-22375205 ACACATATTAAGTGAAAAAAGGG - Intergenic
1052273644 9:26653918-26653940 ATAGATAGTAAGTAGAAAAATGG - Intergenic
1053065394 9:35065202-35065224 ACACTGAGTAATCATAAAATCGG + Intronic
1053725575 9:40996281-40996303 ACTAATAGTAAGTACAAAGTTGG - Intergenic
1054340362 9:63855594-63855616 ACTAATAGTAAGTACAAAGTTGG + Intergenic
1055098204 9:72436263-72436285 AGAAATAGTAAGTAGAGAATAGG - Intergenic
1055124363 9:72702180-72702202 ATATATAGAAAGTTTAAAATTGG + Intronic
1055269528 9:74541964-74541986 CCACATAGGTAGTATAAATTTGG - Intronic
1056701335 9:88912557-88912579 ACACAAGGTAAGTATAAGAAAGG + Intergenic
1058004342 9:99899632-99899654 ACACATAGAAATTAAATAATAGG + Intergenic
1058281856 9:103126266-103126288 ACATATAGGAAGTAAAAATTTGG + Intergenic
1058334742 9:103812324-103812346 ATACATACTAAGTCTAAAAAAGG - Intergenic
1058850895 9:109011854-109011876 CCACATAGTAAGCATTACATAGG + Intronic
1059850437 9:118332103-118332125 ATAAATAGTATGTATAAGATGGG - Intergenic
1060443929 9:123670078-123670100 ATACATATTTAGTATAAATTAGG + Intronic
1061097461 9:128467287-128467309 AAACATAGTAAATATAGAAAAGG + Intronic
1062508642 9:136892133-136892155 TCTTATAATAAGTATAAAATAGG + Intronic
1185505974 X:632372-632394 ATACATCTTAAGAATAAAATGGG + Intronic
1185752124 X:2620401-2620423 ACTATTAATAAGTATAAAATAGG - Intergenic
1186017086 X:5209447-5209469 ACATACAGTAGATATAAAATGGG + Intergenic
1186359053 X:8820439-8820461 ACTAATAGTCAGTACAAAATTGG - Intergenic
1187837364 X:23446835-23446857 TCACATAGAAATAATAAAATTGG - Intergenic
1188217457 X:27496657-27496679 ATACATAATAAGTAAAAAGTGGG - Intergenic
1189571274 X:42300467-42300489 AGAAATAGTAATTATAAAAATGG + Intergenic
1189924618 X:45939532-45939554 ACACATAGTAAGCAGAATGTAGG - Intergenic
1192960078 X:76120828-76120850 AGAGATAGAAAGTATAAAAAAGG + Intergenic
1193424362 X:81323325-81323347 TGTCATAGAAAGTATAAAATTGG + Intergenic
1193625284 X:83812914-83812936 AGACATAGTAGAAATAAAATAGG + Intergenic
1194298524 X:92156769-92156791 ACACATAATGAGTATATAAATGG - Intronic
1194634858 X:96332909-96332931 ACACATAGTACCTCTAGAATGGG + Intergenic
1195142965 X:101981967-101981989 GCACATAGCACGTATAAAAGTGG + Intergenic
1196002680 X:110803553-110803575 ACACATTGTTAGTCTGAAATTGG - Intergenic
1199171949 X:144743090-144743112 ACACATAGAAGGTCTAAAACAGG + Intergenic
1200318853 X:155163498-155163520 ACATATAGTTAGTATATAGTTGG + Intergenic
1200616136 Y:5381731-5381753 ACACATAATGAGTATATAAATGG - Intronic