ID: 924987692

View in Genome Browser
Species Human (GRCh38)
Location 2:287357-287379
Sequence GCGCGCGTGAGCTGCGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924987692_924987696 -8 Left 924987692 2:287357-287379 CCCGCGCCGCAGCTCACGCGCGC 0: 1
1: 0
2: 0
3: 16
4: 178
Right 924987696 2:287372-287394 ACGCGCGCCAGAAGGAGACCAGG 0: 1
1: 0
2: 0
3: 1
4: 42
924987692_924987698 7 Left 924987692 2:287357-287379 CCCGCGCCGCAGCTCACGCGCGC 0: 1
1: 0
2: 0
3: 16
4: 178
Right 924987698 2:287387-287409 AGACCAGGCGCTTCTCCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 72
924987692_924987700 19 Left 924987692 2:287357-287379 CCCGCGCCGCAGCTCACGCGCGC 0: 1
1: 0
2: 0
3: 16
4: 178
Right 924987700 2:287399-287421 TCTCCGCCAGGCCTCATGCGCGG 0: 1
1: 0
2: 1
3: 5
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924987692 Original CRISPR GCGCGCGTGAGCTGCGGCGC GGG (reversed) Intronic
904794773 1:33051091-33051113 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
905806967 1:40884314-40884336 GCGGGTGTGAGCGGCGGGGCAGG + Intergenic
906436815 1:45803576-45803598 GCGCGCGTGAGGGGCGGGGCCGG + Intronic
906436877 1:45803817-45803839 GCGCGGCTGCGCTGCGGCCCGGG + Exonic
906486604 1:46240252-46240274 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
908534758 1:65067153-65067175 GAGCGCGGGGGCGGCGGCGCGGG - Intergenic
910935090 1:92480824-92480846 GCGCCAGGGAGCTGCAGCGCAGG - Exonic
914376936 1:147080188-147080210 GCGGGCGGGAGCTGCGGCTGCGG - Intergenic
915143997 1:153783822-153783844 GCGCGCGAGAGGGGCGGGGCAGG + Intergenic
919638690 1:200029171-200029193 GCGCGCTCTAGCTGCGGCCCCGG - Intronic
919678517 1:200410109-200410131 CCGGGCGGAAGCTGCGGCGCAGG - Intergenic
920394189 1:205631859-205631881 GCACGCGGCAGCGGCGGCGCGGG + Exonic
922502928 1:226110213-226110235 GAGCGCGTGGGCCGCGGCGGAGG + Intergenic
923490417 1:234478940-234478962 GCGCGCGGCAGCGGGGGCGCAGG - Exonic
924957646 1:248944843-248944865 GCGGGAGTGAGGCGCGGCGCAGG - Intergenic
1066022876 10:31319942-31319964 GCGCGCGTGTGCGCGGGCGCCGG + Intronic
1072421151 10:95291192-95291214 GCGCGAGTCAGATGCGGGGCCGG + Intergenic
1072950172 10:99840350-99840372 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1073061758 10:100737540-100737562 GCGGGGGGGAGCTGCGGAGCTGG + Intronic
1076792850 10:132786038-132786060 GCGGGCGTCGGCTGCAGCGCGGG + Exonic
1076963490 10:133786361-133786383 GCGGGAGTGAGGCGCGGCGCAGG - Intergenic
1076993892 11:289256-289278 GCGGCCGGGAGCTGCGGGGCGGG - Intronic
1077043672 11:535302-535324 GCGGGCGTAAGCGGCGGCGGCGG - Intronic
1077048207 11:555396-555418 GCGGGCAGGTGCTGCGGCGCGGG + Exonic
1077049646 11:560957-560979 GCCCGGGTGCGCCGCGGCGCTGG + Intronic
1077419923 11:2445265-2445287 GGGCGCGGGACCTGGGGCGCCGG - Exonic
1083758391 11:64803179-64803201 GCGGGCGCGAGCTGCGGAGCCGG + Exonic
1085719912 11:78903460-78903482 GCGTGCGAGAGCGGCGGCGGCGG + Exonic
1086556963 11:88121836-88121858 ACAGGCGTGAGCTGCCGCGCCGG + Intronic
1091243408 11:134069655-134069677 GAGCGCGGCAGCTGCGGCGTGGG + Intronic
1091273149 11:134331985-134332007 GCGCGCGGGAGCCTCGCCGCGGG - Exonic
1091588389 12:1828727-1828749 GGGCTCGTGGGATGCGGCGCTGG + Intronic
1091807358 12:3366004-3366026 GCCCGCGTGGGGTGGGGCGCCGG - Intergenic
1093958677 12:25250559-25250581 GCGCGCGGACGCGGCGGCGCGGG - Intronic
1094025716 12:25958573-25958595 GCGCGCGAGAGGAGCGGCGCGGG - Intergenic
1094219380 12:27975590-27975612 GGCCGGGTGAGGTGCGGCGCGGG + Intergenic
1095439296 12:42226950-42226972 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1096482413 12:51951576-51951598 GCGCGCGGCGGCCGCGGCGCCGG + Intergenic
1097033226 12:56104549-56104571 GAGCGCGCGGGCTGAGGCGCAGG - Exonic
1099339227 12:81407206-81407228 ACAGGCGTGAGCTGCCGCGCTGG - Intronic
1102084391 12:110124277-110124299 GCGCGCACGAGCTGGGGGGCGGG - Intergenic
1102453513 12:113057524-113057546 GCGCGCCTGGACTGCGGCTCCGG - Intronic
1102884101 12:116508676-116508698 GCGCGCCTGAGCAGCGGCCCTGG - Intergenic
1103270496 12:119669235-119669257 GCAGGCGTGAGCTACGGTGCTGG + Intronic
1103749866 12:123151150-123151172 GCGCGGGGGAGCGGCGGCGGCGG + Intergenic
1104049637 12:125186769-125186791 GCGCGCGGTGGGTGCGGCGCGGG - Intergenic
1104961570 12:132490588-132490610 GCGCGCGCGAGCGCCGGCTCGGG - Exonic
1105517594 13:21104382-21104404 GGGAGCGCGAGCTGGGGCGCGGG + Intergenic
1107624839 13:42272039-42272061 GCGGGCCGGAGCTGCGGCGGCGG + Intergenic
1113655607 13:112066661-112066683 GCGCGCGCGCGCGGCGGCGGCGG - Intergenic
1121050356 14:90816044-90816066 CCGCGAGGGAGCTGCGGCCCAGG - Intronic
1121405379 14:93716438-93716460 GCCTGAGTGAGCTGCTGCGCTGG - Intergenic
1122964070 14:105112920-105112942 GCGCGGCTGCGCTGCGGCCCGGG - Intergenic
1125674168 15:41493807-41493829 GCGCGGGCGTGCAGCGGCGCAGG + Intronic
1127916501 15:63459422-63459444 CCGCCCGTGTGCTGCGGAGCAGG - Intergenic
1130270747 15:82445716-82445738 TGGAGCGTGAGCTGCGGCGGGGG - Intergenic
1130463091 15:84173039-84173061 TGGAGCGTGAGCTGCGGCGGCGG - Intronic
1130489583 15:84421749-84421771 TGGAGCGTGAGCTGCGGCGGCGG + Intergenic
1130501174 15:84500511-84500533 TGGAGCGTGAGCTGCGGCGGCGG + Intergenic
1130540342 15:84817350-84817372 GCGGGCGGGAGCGGCGGCGGCGG + Exonic
1132365173 15:101251702-101251724 GCGCGCGCTAGCGGCGGCTCGGG + Exonic
1132683264 16:1152523-1152545 GCGCGTGTGTGATGGGGCGCGGG - Intergenic
1132927688 16:2439821-2439843 GCGCAGGTGAGGTGCGGGGCTGG + Exonic
1134492310 16:14704180-14704202 GCAGGCGTGAGCCGCCGCGCCGG - Intergenic
1134497691 16:14743302-14743324 GCAGGCGTGAGCCGCCGCGCCGG - Intronic
1134509276 16:14833706-14833728 GCGCGCGTGCGCGGCGGCTCTGG + Exonic
1134974861 16:18562164-18562186 GCGCGCGTGCGCGGCGGCTCTGG - Intronic
1137300537 16:47144040-47144062 GGGCGCGCGAGGCGCGGCGCGGG - Intergenic
1142132373 16:88436931-88436953 GCTCGCGGGAGCTGCTGCGGGGG + Exonic
1142591559 17:1008430-1008452 GCGCGCGTGTGGTGAGGGGCTGG - Intronic
1142811769 17:2398963-2398985 GGGCGGGGGAGCTGCGGGGCCGG - Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143586502 17:7853290-7853312 GCAGGCCTGCGCTGCGGCGCCGG - Exonic
1146371110 17:32266046-32266068 GCGGGCGCGGGCTGCGGAGCGGG + Intergenic
1147231720 17:39024186-39024208 ACAGGCGTGAGCTGCCGCGCAGG + Intergenic
1147617083 17:41836031-41836053 GCGCGCGTGTGAGGCGGGGCCGG + Intronic
1147963136 17:44179794-44179816 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1147969164 17:44210529-44210551 GAGCGCCTGGGCTGCTGCGCGGG - Intronic
1150465253 17:65387132-65387154 ACAGGCGTGAGCTGCCGCGCCGG + Intergenic
1157594774 18:48857912-48857934 GCATGCCTGAGCTGGGGCGCAGG - Intronic
1160653444 19:246643-246665 GCGGGAGTGAGGCGCGGCGCAGG + Intergenic
1160668440 19:344519-344541 GTGCGCATGCGCGGCGGCGCGGG - Intronic
1160740726 19:684476-684498 GCGCGGGTGAGCCACCGCGCTGG - Intergenic
1160948029 19:1652403-1652425 TCGCGCGTGGGCGGCGGCGGCGG + Intronic
1160976766 19:1796628-1796650 GGCCGGGTGAGCTGCGGGGCTGG + Intronic
1161089884 19:2354422-2354444 GCGGGCGGGAGCTGGGGCCCAGG - Intronic
1161451258 19:4346691-4346713 GCGGGCGTGAGCTACTGCACTGG + Intronic
1161479195 19:4502253-4502275 GGGGGCCTGAGCTGGGGCGCAGG + Exonic
1162312080 19:9913732-9913754 ACGAGCGCGAGCTGCGGGGCAGG + Intronic
1162886642 19:13702551-13702573 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1162954360 19:14090209-14090231 GCGCGCGTGCGCTCCGGCTCCGG + Exonic
1163329679 19:16628332-16628354 GCGCGCTTGCGCGGAGGCGCGGG - Intronic
1164191861 19:22925298-22925320 GCGCGGCTGCGCTGCGGCCCAGG + Intergenic
1164653388 19:29901926-29901948 GCGCGGCTGCGCTGCGGCCCGGG - Intergenic
1166107706 19:40605520-40605542 GCGGGCGGAAGCGGCGGCGCGGG + Exonic
1166261380 19:41643977-41643999 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1166991210 19:46693879-46693901 GGGCGCGTGGCCTGGGGCGCTGG + Exonic
1167585918 19:50375817-50375839 ACAGGCGTGAGCTGCGGCACCGG - Intronic
1168728625 19:58606815-58606837 GCGGGAGTGAGGCGCGGCGCAGG - Intergenic
924987692 2:287357-287379 GCGCGCGTGAGCTGCGGCGCGGG - Intronic
925730732 2:6917964-6917986 GCGGGTCTGCGCTGCGGCGCGGG + Intronic
926092392 2:10059242-10059264 GCGCGGGTGAGCCGCAGAGCTGG - Intronic
930177416 2:48314866-48314888 GCGCCCGGGAGCTGCGCCGCGGG - Intronic
936569877 2:113603889-113603911 GCGGGAGTGAGGCGCGGCGCCGG + Intergenic
937203895 2:120223583-120223605 GCGCGCGCGAGCAGAGGCGGTGG + Intergenic
938338978 2:130522998-130523020 GCGCGCGGGTGCGGGGGCGCGGG + Intronic
938350860 2:130597752-130597774 GCGCGCGGGTGCGGGGGCGCGGG - Intronic
938796032 2:134718893-134718915 GCCCCTGGGAGCTGCGGCGCTGG + Exonic
941686847 2:168456323-168456345 GCGGGCGGGAGCAGCGGCGGCGG + Exonic
948213856 2:236214614-236214636 GCGCGCTGCTGCTGCGGCGCGGG - Exonic
948895680 2:240925846-240925868 GCGAGCTGGAGCTGAGGCGCTGG + Exonic
949088886 2:242182452-242182474 GCGGGAGTGAGGCGCGGCGCAGG - Intergenic
1171010706 20:21507940-21507962 GCGCGCGGGCGCTTCGGGGCCGG + Intergenic
1174373970 20:50113090-50113112 GCTCGGGTGAGCGGGGGCGCCGG - Intronic
1175715500 20:61252393-61252415 GCGCGGGGGAGCGGCGGCGGCGG + Intergenic
1176015545 20:62929359-62929381 GCGCGCCTGGGCCTCGGCGCTGG + Intronic
1176159806 20:63642317-63642339 GCGCGCGTGAGCGGCAACCCCGG + Intronic
1177166868 21:17612997-17613019 GCGCGCCTGAGGGGCGGTGCCGG + Intergenic
1180264108 21:46698734-46698756 GCGGGAGTGAGGCGCGGCGCAGG - Intergenic
1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG + Intronic
1181670553 22:24423882-24423904 GCGCCCGTGAGCGGCGCGGCCGG + Intronic
1182604000 22:31489577-31489599 GCGTGCGTGAGCGCGGGCGCCGG - Exonic
1183683637 22:39349798-39349820 GGGCGCGCGTGCTGCGGCCCGGG - Intergenic
1184378511 22:44130370-44130392 GCGGGCGTGGGGTGGGGCGCTGG + Intronic
1185430346 22:50807115-50807137 GCGGGAGTGAGGCGCGGCGCAGG - Intergenic
950024295 3:9810038-9810060 GCGCGAGGGAGCTGGGGCCCGGG + Exonic
954382577 3:50227476-50227498 GCGGGCCTGGGGTGCGGCGCGGG - Intronic
954656682 3:52198264-52198286 CCGCGCGGTAGGTGCGGCGCCGG + Intronic
956290362 3:67654459-67654481 GCGGGCGCCAGCAGCGGCGCCGG - Intronic
967904010 3:194486529-194486551 GGGCGGGTGGGCAGCGGCGCCGG - Intronic
968457094 4:705521-705543 ACGATCGTGAGCTGGGGCGCTGG - Intergenic
968613886 4:1568778-1568800 GCGCGGGTGGGAGGCGGCGCGGG - Intergenic
968640513 4:1712296-1712318 GAGCTCGTGAGCGCCGGCGCGGG - Exonic
968764737 4:2462499-2462521 GCGTGCAGCAGCTGCGGCGCAGG + Exonic
968775349 4:2536739-2536761 GCGGGCGGGAGCTGCGGGGCAGG - Intronic
968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG + Intronic
971257897 4:25030753-25030775 GCCCGCGTCTGCAGCGGCGCCGG - Exonic
971294591 4:25377235-25377257 GCGCGCGACAGCGGCGGGGCGGG + Intronic
973635877 4:52861965-52861987 GCGCGCGTGGGCTGTGGAGCCGG + Intergenic
982616151 4:157637978-157638000 GCGCGGCTGCGCTGCGGCGCGGG - Intergenic
985328276 4:188797062-188797084 GCGTCTGTGAGGTGCGGCGCAGG - Intergenic
985328299 4:188797209-188797231 GCGTCTGTGAGATGCGGCGCAGG - Intergenic
985466715 4:190203659-190203681 GCGGGAGTGAGGCGCGGCGCAGG - Intergenic
985703966 5:1390084-1390106 GGGCCCGTGAGCTGCGGCACTGG - Intergenic
992067302 5:73120178-73120200 GCGCGAGAGAGCGGCGGCGTGGG - Intergenic
992373664 5:76170851-76170873 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
992401284 5:76414076-76414098 GGGCACGTGAGTTGCGGCCCAGG - Intronic
992769673 5:80035416-80035438 GCACGGGTCACCTGCGGCGCCGG + Exonic
993499849 5:88653031-88653053 ACAGGCGTGAGCTGCCGCGCCGG + Intergenic
995650161 5:114361299-114361321 GCCCAAGTGCGCTGCGGCGCGGG - Intronic
1000985194 5:167858621-167858643 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1002252821 5:177939957-177939979 GCGCCCGCGAGCAGCGGGGCTGG + Intergenic
1002341468 5:178519027-178519049 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1006337528 6:33428198-33428220 GCGCGCGTGTGCGTGGGCGCGGG + Intronic
1007589726 6:43013870-43013892 GCGCGCGGGAACACCGGCGCCGG - Exonic
1007674483 6:43581777-43581799 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1012986350 6:105880408-105880430 GGGCGCGTGTGCTCCGGCACAGG - Intergenic
1015476483 6:133664081-133664103 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1021600212 7:22356946-22356968 GGGCGCTGGGGCTGCGGCGCAGG + Intronic
1021731262 7:23597633-23597655 GCGCGCGAGAGGTGCGGGCCCGG - Intronic
1022410422 7:30135358-30135380 CCGCGCGGGAGCTCGGGCGCAGG - Intronic
1022815063 7:33905462-33905484 GCGCCCGAGAGCTGGGGGGCGGG - Exonic
1024993584 7:55254767-55254789 GCCGGCGTGAGCTGCAGGGCTGG - Intronic
1025261689 7:57424681-57424703 ACGCGCGGGAGCTGCCCCGCGGG + Intergenic
1026270050 7:68828770-68828792 ATGCGGGTGAGCTGCGGAGCCGG - Intergenic
1026665471 7:72336904-72336926 GCGCGCGTGGGGAGCGGCCCGGG - Intronic
1026909416 7:74083762-74083784 GGGCCTGTGAGCTGCGGCACGGG - Intronic
1026923806 7:74174780-74174802 GCGGGGCTGAGCTGTGGCGCTGG + Intronic
1029538796 7:101171210-101171232 GCTCGGGTGAGCTGGGGCACGGG + Exonic
1032062867 7:128739363-128739385 GCGCGCGTGAGCTGAGCCGGTGG + Exonic
1034963112 7:155374427-155374449 GCGCGTGTGGGCGGAGGCGCCGG + Intergenic
1035512965 8:206377-206399 GCGGGAGTGAGGCGCGGCGCAGG + Intergenic
1035609397 8:949791-949813 GCCCGCGTGACCTGCGTCCCAGG - Intergenic
1039979102 8:42391692-42391714 GCGCACGCGCGCTGCGGAGCCGG + Intronic
1041686934 8:60652587-60652609 CCGCGCGTGAGAACCGGCGCGGG + Intergenic
1042903028 8:73746963-73746985 GGGCGCGGGAGCGGCTGCGCAGG - Intronic
1043847292 8:85177529-85177551 GCGCCCCCGAGCTGCGGCGGCGG - Exonic
1047940830 8:129826168-129826190 ACGCGGGTGACCTGCAGCGCCGG - Intergenic
1049788672 8:144463082-144463104 GCCCACGCGAGCTGTGGCGCCGG + Intronic
1053457017 9:38241342-38241364 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1056413493 9:86354619-86354641 GAGCGAGTGCGCTGGGGCGCCGG - Intergenic
1058861289 9:109119837-109119859 GCGCGCGGGACCCGCGGCGCCGG + Exonic
1059145548 9:111896680-111896702 CCGCGCGCCCGCTGCGGCGCCGG - Intergenic
1059210809 9:112513502-112513524 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1060064729 9:120494855-120494877 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1060643861 9:125261775-125261797 GCGCGCGTGCGCAGCGCCGCGGG - Intronic
1060770189 9:126326858-126326880 TCGCGCTCGAGCTGCGGCGCCGG + Exonic
1061967751 9:134025613-134025635 GCGCGCGGGGTCTGGGGCGCGGG + Intergenic
1062272106 9:135714386-135714408 GCGCGCGGGACCGGCTGCGCCGG - Intronic
1062547502 9:137070260-137070282 ACGCGCGGGAGCTGCCCCGCGGG - Exonic
1062596434 9:137301971-137301993 GCGGGCGGCGGCTGCGGCGCGGG + Exonic
1187648324 X:21374143-21374165 GTGCGCGTGCGCGGCGGCGGAGG - Intergenic
1190024657 X:46912523-46912545 GAGGGCGGGAGCTGAGGCGCGGG + Exonic
1190266902 X:48832040-48832062 GCGCGAGCGAGCTGCGCTGCAGG + Exonic
1190285417 X:48957958-48957980 GCGCGCGTGCGCAGCGCCCCGGG - Intronic