ID: 924987692

View in Genome Browser
Species Human (GRCh38)
Location 2:287357-287379
Sequence GCGCGCGTGAGCTGCGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924987692_924987700 19 Left 924987692 2:287357-287379 CCCGCGCCGCAGCTCACGCGCGC 0: 1
1: 0
2: 0
3: 16
4: 178
Right 924987700 2:287399-287421 TCTCCGCCAGGCCTCATGCGCGG 0: 1
1: 0
2: 1
3: 5
4: 113
924987692_924987698 7 Left 924987692 2:287357-287379 CCCGCGCCGCAGCTCACGCGCGC 0: 1
1: 0
2: 0
3: 16
4: 178
Right 924987698 2:287387-287409 AGACCAGGCGCTTCTCCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 72
924987692_924987696 -8 Left 924987692 2:287357-287379 CCCGCGCCGCAGCTCACGCGCGC 0: 1
1: 0
2: 0
3: 16
4: 178
Right 924987696 2:287372-287394 ACGCGCGCCAGAAGGAGACCAGG 0: 1
1: 0
2: 0
3: 1
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924987692 Original CRISPR GCGCGCGTGAGCTGCGGCGC GGG (reversed) Intronic