ID: 924987696

View in Genome Browser
Species Human (GRCh38)
Location 2:287372-287394
Sequence ACGCGCGCCAGAAGGAGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924987692_924987696 -8 Left 924987692 2:287357-287379 CCCGCGCCGCAGCTCACGCGCGC 0: 1
1: 0
2: 0
3: 16
4: 178
Right 924987696 2:287372-287394 ACGCGCGCCAGAAGGAGACCAGG 0: 1
1: 0
2: 0
3: 1
4: 42
924987690_924987696 -1 Left 924987690 2:287350-287372 CCACCGACCCGCGCCGCAGCTCA 0: 1
1: 0
2: 0
3: 12
4: 166
Right 924987696 2:287372-287394 ACGCGCGCCAGAAGGAGACCAGG 0: 1
1: 0
2: 0
3: 1
4: 42
924987691_924987696 -4 Left 924987691 2:287353-287375 CCGACCCGCGCCGCAGCTCACGC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 924987696 2:287372-287394 ACGCGCGCCAGAAGGAGACCAGG 0: 1
1: 0
2: 0
3: 1
4: 42
924987693_924987696 -9 Left 924987693 2:287358-287380 CCGCGCCGCAGCTCACGCGCGCC 0: 1
1: 0
2: 0
3: 14
4: 199
Right 924987696 2:287372-287394 ACGCGCGCCAGAAGGAGACCAGG 0: 1
1: 0
2: 0
3: 1
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924987696 Original CRISPR ACGCGCGCCAGAAGGAGACC AGG Intronic