ID: 924987698

View in Genome Browser
Species Human (GRCh38)
Location 2:287387-287409
Sequence AGACCAGGCGCTTCTCCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924987690_924987698 14 Left 924987690 2:287350-287372 CCACCGACCCGCGCCGCAGCTCA 0: 1
1: 0
2: 0
3: 12
4: 166
Right 924987698 2:287387-287409 AGACCAGGCGCTTCTCCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 72
924987693_924987698 6 Left 924987693 2:287358-287380 CCGCGCCGCAGCTCACGCGCGCC 0: 1
1: 0
2: 0
3: 14
4: 199
Right 924987698 2:287387-287409 AGACCAGGCGCTTCTCCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 72
924987691_924987698 11 Left 924987691 2:287353-287375 CCGACCCGCGCCGCAGCTCACGC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 924987698 2:287387-287409 AGACCAGGCGCTTCTCCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 72
924987694_924987698 1 Left 924987694 2:287363-287385 CCGCAGCTCACGCGCGCCAGAAG 0: 1
1: 0
2: 0
3: 5
4: 41
Right 924987698 2:287387-287409 AGACCAGGCGCTTCTCCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 72
924987692_924987698 7 Left 924987692 2:287357-287379 CCCGCGCCGCAGCTCACGCGCGC 0: 1
1: 0
2: 0
3: 16
4: 178
Right 924987698 2:287387-287409 AGACCAGGCGCTTCTCCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924987698 Original CRISPR AGACCAGGCGCTTCTCCGCC AGG Intronic