ID: 924987700

View in Genome Browser
Species Human (GRCh38)
Location 2:287399-287421
Sequence TCTCCGCCAGGCCTCATGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924987697_924987700 -3 Left 924987697 2:287379-287401 CCAGAAGGAGACCAGGCGCTTCT 0: 1
1: 0
2: 0
3: 12
4: 102
Right 924987700 2:287399-287421 TCTCCGCCAGGCCTCATGCGCGG 0: 1
1: 0
2: 1
3: 5
4: 113
924987691_924987700 23 Left 924987691 2:287353-287375 CCGACCCGCGCCGCAGCTCACGC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 924987700 2:287399-287421 TCTCCGCCAGGCCTCATGCGCGG 0: 1
1: 0
2: 1
3: 5
4: 113
924987693_924987700 18 Left 924987693 2:287358-287380 CCGCGCCGCAGCTCACGCGCGCC 0: 1
1: 0
2: 0
3: 14
4: 199
Right 924987700 2:287399-287421 TCTCCGCCAGGCCTCATGCGCGG 0: 1
1: 0
2: 1
3: 5
4: 113
924987690_924987700 26 Left 924987690 2:287350-287372 CCACCGACCCGCGCCGCAGCTCA 0: 1
1: 0
2: 0
3: 12
4: 166
Right 924987700 2:287399-287421 TCTCCGCCAGGCCTCATGCGCGG 0: 1
1: 0
2: 1
3: 5
4: 113
924987692_924987700 19 Left 924987692 2:287357-287379 CCCGCGCCGCAGCTCACGCGCGC 0: 1
1: 0
2: 0
3: 16
4: 178
Right 924987700 2:287399-287421 TCTCCGCCAGGCCTCATGCGCGG 0: 1
1: 0
2: 1
3: 5
4: 113
924987694_924987700 13 Left 924987694 2:287363-287385 CCGCAGCTCACGCGCGCCAGAAG 0: 1
1: 0
2: 0
3: 5
4: 41
Right 924987700 2:287399-287421 TCTCCGCCAGGCCTCATGCGCGG 0: 1
1: 0
2: 1
3: 5
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924987700 Original CRISPR TCTCCGCCAGGCCTCATGCG CGG Intronic