ID: 924987713

View in Genome Browser
Species Human (GRCh38)
Location 2:287550-287572
Sequence CCGAGCGCGCCCGAGGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924987713_924987724 9 Left 924987713 2:287550-287572 CCCCGGCCCTCGGGCGCGCTCGG 0: 1
1: 0
2: 1
3: 14
4: 138
Right 924987724 2:287582-287604 CCCACTCGCTGCTCCGGCGAAGG 0: 1
1: 0
2: 0
3: 3
4: 54
924987713_924987722 3 Left 924987713 2:287550-287572 CCCCGGCCCTCGGGCGCGCTCGG 0: 1
1: 0
2: 1
3: 14
4: 138
Right 924987722 2:287576-287598 CACTCACCCACTCGCTGCTCCGG 0: 1
1: 0
2: 1
3: 16
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924987713 Original CRISPR CCGAGCGCGCCCGAGGGCCG GGG (reversed) Intronic
900237600 1:1600138-1600160 CCGAGCGCGCACGGGGCGCGGGG - Intergenic
900287495 1:1908651-1908673 CCCAGCGCGCCCGGTGGCCCAGG - Intergenic
901250137 1:7771571-7771593 CCGCGTCCGCCCGATGGCCGCGG - Intronic
902286118 1:15409804-15409826 CCGCGCGGGCCCGGGGGCGGGGG + Intergenic
902311513 1:15584926-15584948 CCGGGTGCGCCCGGGGCCCGGGG - Exonic
904724834 1:32539530-32539552 CCGGTCGCGCGCGCGGGCCGAGG - Exonic
905847133 1:41242286-41242308 CCGCGCGAGCCCAACGGCCGAGG - Intergenic
907689222 1:56645552-56645574 CCGCGCCCGCCGGAGGCCCGGGG - Intronic
908751584 1:67429694-67429716 TCGAGCGCGCTCGAGGTCCTGGG - Intronic
911247508 1:95535141-95535163 CAGAGCTCCCCTGAGGGCCGAGG + Intergenic
915224962 1:154405438-154405460 CCGAGCGCGGCGCGGGGCCGAGG + Exonic
915590668 1:156868475-156868497 CCCAGGACGCCCGAGGGCCAAGG - Intronic
917853134 1:179082180-179082202 CCGGGCGCGCCTGAGCCCCGCGG + Exonic
921396466 1:214673662-214673684 CCGAGAGCGAGCGAGGGCTGTGG + Intergenic
921671107 1:217925064-217925086 CCGAGCGCGCCCAGGGCCTGGGG - Intergenic
1065214701 10:23438881-23438903 CCGCGCGCGCTCGCGCGCCGAGG + Intergenic
1069976356 10:72216300-72216322 CCGAGTGCGCATGCGGGCCGAGG + Intronic
1070152100 10:73811429-73811451 CTGAGCGCGACCGTGGGCGGGGG + Intronic
1075801959 10:125159743-125159765 CCGAGCGCGCCGGGGTGCGGCGG - Intronic
1076116895 10:127907219-127907241 CCGGGCGCCCCGGAGGGCGGCGG + Exonic
1077919046 11:6629816-6629838 CCGAGCGCGGCGGGGAGCCGTGG + Exonic
1078514103 11:12008508-12008530 CGGAGCGGGCGCGGGGGCCGTGG + Exonic
1082028646 11:47589716-47589738 CCAGGCGCGCCCGGAGGCCGTGG + Exonic
1083273027 11:61581388-61581410 CCGTGCTCCCCCGATGGCCGCGG + Intergenic
1084296043 11:68213827-68213849 CCGGGCGCTCCCGACGGCGGAGG + Intronic
1088481787 11:110301422-110301444 CCGAGAGCGAGCGAGGGCTGAGG + Intergenic
1089273244 11:117315802-117315824 CCCAGAGGGCCCGAAGGCCGGGG - Exonic
1090699135 11:129279118-129279140 GCGGGCGCGCGGGAGGGCCGGGG - Intronic
1092462507 12:8698425-8698447 CCGAGCGCGCCCGGGGTCCGGGG + Intronic
1102150935 12:110688913-110688935 CCGAGGGCAACCGAGGGCTGGGG + Intronic
1102245934 12:111355772-111355794 CTGAGAGCAGCCGAGGGCCGGGG - Intergenic
1102645427 12:114400625-114400647 GCGAGCGCGCCCGGAGGCGGAGG + Intronic
1103355624 12:120317603-120317625 CTGTGCGCGCCAGAGGGGCGGGG + Intergenic
1104568284 12:129903892-129903914 GCGCGCGCGCCCGAGCCCCGAGG - Intergenic
1106157292 13:27171175-27171197 CAGAGCGCGGCCCCGGGCCGGGG - Intronic
1106340240 13:28820238-28820260 CCGCCCCCGCTCGAGGGCCGGGG - Intergenic
1114989056 14:28264440-28264462 CCGGGAGCGCCCCCGGGCCGCGG + Intergenic
1120844081 14:89111492-89111514 CCGAGAGCGAGCGAGGGCTGTGG - Intergenic
1122270798 14:100567789-100567811 CCGAGGCCGCCCGCGGGCCCTGG + Intronic
1122772528 14:104103735-104103757 CCCAGGGAGCCTGAGGGCCGTGG - Intronic
1122975105 14:105167813-105167835 CCGAGCGCGGGCGCGGGCCCGGG - Exonic
1123036916 14:105475286-105475308 CCGCGCGCTCCCGTGGGCCTGGG + Intronic
1127342863 15:58065710-58065732 GCGAGCGCGCCCCCGGGCCGCGG - Exonic
1127982630 15:64046083-64046105 CGGAGGGCGCCCCAGGGCAGCGG + Intronic
1131263567 15:90902788-90902810 CGGAGCGCGCCGGCGGCCCGGGG + Intronic
1132544737 16:527958-527980 GCGAGCGGGCCCGGGGGCCGGGG + Exonic
1133029733 16:3004659-3004681 ACGAGCGCGCCCACGGGCCCAGG - Intergenic
1134070054 16:11255359-11255381 CCGCGGGCGCGCGGGGGCCGCGG + Exonic
1136491305 16:30610082-30610104 CCGCCAGCGCCCGAGGGCCGAGG - Exonic
1138178708 16:54928780-54928802 CCGCGCGGGCGCGCGGGCCGCGG + Intergenic
1141515856 16:84544566-84544588 CCGAGCACCCACGAGGGCCCAGG + Intronic
1141526960 16:84617951-84617973 CCGAGCGCGCCCCTGGCCGGCGG + Exonic
1141989649 16:87602684-87602706 CTGCGGGCGCCCGAGGGCGGCGG - Intronic
1142102691 16:88283984-88284006 CCGAGTGTGCCCGAGGTCTGTGG + Intergenic
1142163387 16:88570777-88570799 CCCAGGGCGCCCCAGGACCGCGG - Intronic
1142176902 16:88649665-88649687 CTGAGCGTGCCCCAGGGCCTCGG - Intronic
1145049509 17:19648584-19648606 CCGAGCGCGGCCACGGGCCAGGG - Intronic
1152426380 17:80220660-80220682 CCGAGCAAGGCCGAGGGCCGCGG - Intronic
1153882443 18:9433249-9433271 CCCAGCGCTCTGGAGGGCCGAGG - Intergenic
1154501079 18:14998342-14998364 CCGAGCGCGCACCAGGGCCTGGG - Intergenic
1158546797 18:58404220-58404242 CCGACTGCCCCCGTGGGCCGCGG + Intergenic
1158962206 18:62596469-62596491 CCGGGGGCGCCCGAAGGCCCAGG - Intergenic
1160696107 19:485317-485339 CCGGGCGTGCCCGAGCCCCGTGG + Intergenic
1161003077 19:1920891-1920913 CCGCACGTGCACGAGGGCCGAGG - Intronic
1161339015 19:3730521-3730543 ACGAGCGCTCCCGCCGGCCGAGG + Exonic
1161395858 19:4044535-4044557 GCGGGGGCGCCCGGGGGCCGGGG - Exonic
1162572180 19:11480131-11480153 CCGGGTGCGGCCGAGGCCCGGGG + Intronic
1162954687 19:14091293-14091315 CCAGGCGCGCCTGAGGGACGCGG - Intergenic
1163575700 19:18109877-18109899 CCCAGAGAGCCCCAGGGCCGGGG + Intronic
1163607066 19:18281364-18281386 CGGGGCGCCCCCGACGGCCGCGG - Exonic
1165080106 19:33302068-33302090 CCGGGCGCGCCCGCGGGCCCCGG - Exonic
1165419961 19:35717818-35717840 CCGAGGGCGCCGGCCGGCCGCGG + Intergenic
1165851452 19:38852218-38852240 CCGCGCGCGGCCGGGGGCCAGGG - Intronic
1166106730 19:40601333-40601355 CCCAGCCCGCCCGAGGGGCCCGG - Intronic
1166361318 19:42254029-42254051 CCGCGCGAGCCCGGGGGCGGCGG + Intronic
1167703566 19:51065341-51065363 CCCAGCTCGCCAGAGGGCAGGGG - Intergenic
924987713 2:287550-287572 CCGAGCGCGCCCGAGGGCCGGGG - Intronic
925027505 2:621281-621303 CTGCGCGCGCCCCAGGGCGGAGG - Intergenic
925291412 2:2750991-2751013 CAGACCGCGCCCGAGGTCCCTGG + Intergenic
927811763 2:26184421-26184443 CCCAGCGAGCGCGGGGGCCGCGG + Exonic
932036657 2:68252653-68252675 CAGAGCTCGCCAGAGCGCCGCGG - Intronic
932758787 2:74426332-74426354 CCGAGCGAGCCCTAGGGGAGTGG + Exonic
932779114 2:74549086-74549108 CGGCGCGCGCCCCGGGGCCGAGG + Intronic
935692748 2:105745264-105745286 CCGAGAGCACCGGAGGGGCGCGG - Intronic
936368631 2:111884003-111884025 CCGAGGAGGCCCGAGGGCAGCGG + Exonic
936412974 2:112276281-112276303 CGGAGCCCGCCCGGGGGGCGGGG - Intronic
938296577 2:130182754-130182776 TCGAGCGTGCCCGAGACCCGAGG + Exonic
938460171 2:131491875-131491897 TCGAGCGTGCCCGAGACCCGAGG - Exonic
938500247 2:131828531-131828553 CCGAGCGCGCACCAGGGCCTGGG - Intergenic
942463840 2:176188489-176188511 CCCAGCGCCCCCGAGCCCCGAGG - Intergenic
946308801 2:218871610-218871632 CCGGGCAGGCCGGAGGGCCGGGG - Exonic
946395567 2:219442205-219442227 CCGAGCCCCGCCGAGGGCGGCGG + Intronic
947399211 2:229714873-229714895 CCGAGTGCGCCCCAAGGCCCGGG + Intergenic
947641259 2:231708971-231708993 CCGGGCGCCCTCGGGGGCCGAGG + Intronic
1169557681 20:6767921-6767943 CAGAGCGCGCCACAGCGCCGTGG + Exonic
1171896386 20:30813782-30813804 CTGAGCGTGCCCACGGGCCGCGG + Intergenic
1173488490 20:43458585-43458607 CCGGGCAGGCGCGAGGGCCGGGG + Intronic
1173566159 20:44039937-44039959 CCGAGGTGGGCCGAGGGCCGGGG + Intronic
1173663597 20:44750641-44750663 CCGGGGGCGCCCGAGAGCCGTGG + Exonic
1176135628 20:63520920-63520942 ACGAGCAGGCCCGAGGGGCGGGG + Intronic
1178680366 21:34669076-34669098 CCAATCTCGCCCGCGGGCCGCGG - Intergenic
1180950538 22:19718703-19718725 CCGAGCGTGCCCCCGGGCCTGGG + Intronic
1184276399 22:43411753-43411775 CCGAGCCCGGGCGGGGGCCGAGG + Intronic
954909092 3:54088012-54088034 CTGAGCTCGCCCGAGGTCCGAGG + Intergenic
957804992 3:85134376-85134398 CCGAGAGCGAGCGAGGGCCGTGG + Intronic
963189004 3:142448096-142448118 CCGAGGCCGTCCGAGGGGCGGGG + Intergenic
964344673 3:155744264-155744286 CCAAGAGCGCCCGAGCGGCGCGG - Intronic
967214612 3:187199623-187199645 CCGAGCCCGCCCGCTGGGCGCGG - Exonic
967266843 3:187698917-187698939 CCGAGCCCGCCCGCTGGGCGCGG + Exonic
967858548 3:194135215-194135237 CCGAGGCCGCCCGCGGGGCGAGG + Intergenic
968258194 3:197298013-197298035 GCGAGCGGGCCGGGGGGCCGCGG - Intronic
968612200 4:1562441-1562463 CCGAGAGCGGCCGAGGCGCGAGG + Intergenic
968693268 4:2008023-2008045 CAGAGCGCTCCGGACGGCCGGGG + Intronic
968775402 4:2536873-2536895 CAGAGCGGGCGCGGGGGCCGCGG - Intronic
970195635 4:13547773-13547795 CTGCGCGCCCCCGAGGGCCGGGG - Intergenic
970407666 4:15778842-15778864 CCGAGCGTGCCCGCGGGAGGCGG + Intronic
974047153 4:56907964-56907986 GCGAGCGCCGCCGAGGCCCGGGG + Exonic
979189247 4:117835728-117835750 CTGAGTTCGCCCGAGGGCGGTGG - Intergenic
979205575 4:118033639-118033661 CCGGGCGGGTCCCAGGGCCGTGG + Intronic
981782888 4:148445591-148445613 CCGAGCGGGCACGAGGGCGCGGG - Intergenic
985068403 4:186144876-186144898 CCGGGCGCGCCCGGGGTCCGCGG - Exonic
985445547 4:190019379-190019401 CCGAGCGTGCCCACGGGCCCCGG - Intergenic
1001680773 5:173555391-173555413 CCGATGGCGCCCGCGGGCTGCGG - Intergenic
1002929054 6:1620822-1620844 CCAAGCGGGCCCAAGGCCCGAGG - Intergenic
1010926726 6:81753333-81753355 CCGCGCACGCCCGAGGCCCGTGG - Intergenic
1017174959 6:151494101-151494123 CCGAGCGCGCCCCCGGGCTCGGG + Exonic
1017793620 6:157823024-157823046 CCAAGGGCGCCCGGGGGCGGCGG + Intronic
1018400571 6:163415429-163415451 CCGGGCGGGACCGAGCGCCGGGG + Intronic
1020899707 7:13989831-13989853 CCGAGCACCCCCTAGGGCAGAGG - Exonic
1027138290 7:75639439-75639461 CCGTGCGAGCCCGGGGGCCGCGG - Intronic
1027190802 7:75994542-75994564 CCCAGCGGGCCCGGGGGCGGGGG + Exonic
1034306297 7:150047704-150047726 CCGCCTGCGCCCGCGGGCCGAGG + Intergenic
1034800550 7:154052949-154052971 CCGCCTGCGCCCGCGGGCCGAGG - Intronic
1034977609 7:155457603-155457625 CCGAGCCCGCGCGGAGGCCGAGG + Intergenic
1036930600 8:12951950-12951972 GGGAGCGCGCGCGCGGGCCGGGG - Intronic
1038008839 8:23457699-23457721 CGGAGCGCGCCCGCTGGCGGCGG + Intergenic
1038017720 8:23529313-23529335 CCGAGCTCTCCCCAGGACCGCGG + Intronic
1041464558 8:58145793-58145815 CCCTGCGCGGCCGAGGGTCGTGG - Intronic
1042962945 8:74321704-74321726 CCGCGCGCGCCCGCCTGCCGAGG - Intronic
1045336187 8:101205885-101205907 CCGAGCGCGCCGGAGAGGAGGGG - Intronic
1046547321 8:115668507-115668529 CCGAGCGGGCCGCGGGGCCGGGG - Intronic
1047982308 8:130196089-130196111 CCGAGCACGCTGGAAGGCCGAGG + Intronic
1049242864 8:141547481-141547503 CCAAGCGCTCCCCAGGGCAGAGG - Intergenic
1051174364 9:14347883-14347905 CCGAGCGCGCGCGCGCGCCAGGG + Intronic
1053749019 9:41235093-41235115 CTGAGCGTGCCCACGGGCCGCGG + Intergenic
1054254454 9:62799946-62799968 CTGAGCGTGCCCACGGGCCGCGG + Intergenic
1055315273 9:75028247-75028269 GCGAGCCAGGCCGAGGGCCGCGG - Exonic
1057881643 9:98796653-98796675 CCGGGAGCGCGCTAGGGCCGGGG + Intronic
1058058573 9:100473323-100473345 CCGGGCGCGTGCGAGGGTCGCGG - Exonic
1060114346 9:120928803-120928825 GTGAGCCCGCCCGAGGGCGGGGG + Intronic
1060478081 9:124000066-124000088 CCCGGCCCGCCCGAGGGCCCTGG + Intergenic
1061186887 9:129060083-129060105 CCGTGCTCGCCCAAGGGCTGAGG - Intronic
1061717829 9:132531889-132531911 CCGAGCCCGCAGGAGGGCTGAGG + Intronic
1062432868 9:136533713-136533735 CCGAGCCTGCCCGGGGGCTGAGG - Intronic