ID: 924988065

View in Genome Browser
Species Human (GRCh38)
Location 2:288742-288764
Sequence GCCTGACGTCGGCGGGCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924988065_924988075 0 Left 924988065 2:288742-288764 CCCCGCGCCCGCCGACGTCAGGC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 924988075 2:288765-288787 GGGTCCCCAAGGGCTCCGAGCGG 0: 1
1: 0
2: 2
3: 17
4: 146
924988065_924988076 1 Left 924988065 2:288742-288764 CCCCGCGCCCGCCGACGTCAGGC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 924988076 2:288766-288788 GGTCCCCAAGGGCTCCGAGCGGG 0: 1
1: 0
2: 2
3: 13
4: 143
924988065_924988074 -10 Left 924988065 2:288742-288764 CCCCGCGCCCGCCGACGTCAGGC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 924988074 2:288755-288777 GACGTCAGGCGGGTCCCCAAGGG 0: 1
1: 0
2: 0
3: 1
4: 54
924988065_924988077 2 Left 924988065 2:288742-288764 CCCCGCGCCCGCCGACGTCAGGC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 924988077 2:288767-288789 GTCCCCAAGGGCTCCGAGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924988065 Original CRISPR GCCTGACGTCGGCGGGCGCG GGG (reversed) Intronic
900626854 1:3612222-3612244 GCCTGGAGTGGGTGGGCGCGGGG + Intergenic
903384645 1:22918398-22918420 GCCTGGCGGGGGCGGGCGTGCGG + Intergenic
903811376 1:26036689-26036711 GCTTGACCTCGGCGGGCCCCTGG + Intergenic
911188559 1:94926811-94926833 GCCTGGCTCGGGCGGGCGCGGGG - Intronic
919928894 1:202208630-202208652 GCGTGGCGTCGGCTGGCGGGGGG - Intronic
923372614 1:233328129-233328151 GCTCGGCCTCGGCGGGCGCGGGG + Exonic
923612042 1:235504368-235504390 CCCAGACGTCGCCGAGCGCGAGG - Exonic
1063660974 10:8034929-8034951 GCCTGGCATCCGCGGGCGCCCGG + Intergenic
1064544501 10:16437107-16437129 GCCCGACGGCGGAGGCCGCGCGG + Intronic
1065188926 10:23193235-23193257 GCCGGGCGGCGGCGGGCGCCTGG + Exonic
1068475383 10:57517411-57517433 GCCTGTCGTCGGGGGGTGGGAGG - Intergenic
1071997511 10:91162859-91162881 CGCTGGCGGCGGCGGGCGCGGGG - Intergenic
1075768793 10:124916738-124916760 GGGTGACGTCAGCCGGCGCGCGG - Intergenic
1076007659 10:126960580-126960602 GCCTGAAGTTGGAGGGCGCATGG + Intronic
1077021575 11:419409-419431 GCCTGCCGTCAGTGGGCGCAGGG + Intronic
1077250236 11:1557597-1557619 GCCTGGCCCCGGCGGGCGCCTGG - Intronic
1094848104 12:34370251-34370273 GTCTGACTTCTGTGGGCGCGAGG + Intergenic
1104831395 12:131754395-131754417 GCTGGACGTCGGGGGGCGGGGGG - Exonic
1105011931 12:132761885-132761907 GCCTGACGGCGCCGCGCTCGAGG + Exonic
1107110866 13:36696596-36696618 GTCTGAACTCGGCGGGCGGGTGG + Exonic
1112290646 13:98142517-98142539 CCAGGACGTGGGCGGGCGCGGGG + Intergenic
1112291020 13:98143743-98143765 GCCCGACGTCGGCGGAGGTGAGG - Intronic
1122779157 14:104136372-104136394 GCGCGGCGGCGGCGGGCGCGCGG + Intergenic
1129763975 15:78149500-78149522 GCCGGGTGTGGGCGGGCGCGTGG + Intronic
1130380240 15:83365677-83365699 GCCAGATGTCGGCGCCCGCGGGG + Intergenic
1131272661 15:90956684-90956706 GCCTGGCTGCGGCGGGCCCGGGG - Exonic
1131829233 15:96343798-96343820 GGATGAGGTCGGGGGGCGCGGGG + Intergenic
1132314289 15:100879387-100879409 GCCCGACTTCGGCCGGCTCGCGG - Exonic
1132766902 16:1539001-1539023 GCCTGAGGTGGGGGGCCGCGTGG - Intronic
1133784178 16:8962798-8962820 TCCTGACCTCCCCGGGCGCGGGG - Intronic
1134070178 16:11255833-11255855 GCCAGCAGGCGGCGGGCGCGGGG - Intronic
1136220066 16:28823131-28823153 GCCCGCCGTGGGCGGGCGGGGGG - Exonic
1142271831 16:89093912-89093934 GCCCGACCCCGGCGCGCGCGCGG + Exonic
1144931004 17:18858462-18858484 GCCAGGGGTCGGCGGGGGCGGGG + Intronic
1145960899 17:28886042-28886064 GCCTGACGCCTGGGGGCGGGGGG + Intronic
1147981897 17:44280008-44280030 GCCTGGCGTAGGGGGGCGCCTGG + Intergenic
1147987572 17:44315323-44315345 GCGCGACGCCGGCGGGCCCGGGG + Intronic
1148028018 17:44601651-44601673 GCCTGAAGTCAGGGGGCGCGGGG + Intergenic
1148747547 17:49927106-49927128 CCCTGACGTCGTGGGGCGAGCGG + Intergenic
1150830263 17:68512521-68512543 GACGGGCGGCGGCGGGCGCGAGG - Exonic
1151783855 17:76265671-76265693 GCCGGGCGGCGGCGGGGGCGGGG + Intronic
1153886981 18:9475770-9475792 GCCTGACAGACGCGGGCGCGAGG - Intronic
1160616150 18:80130738-80130760 ACCTGACGTGGGCGGGGGGGCGG - Intronic
1160745377 19:708931-708953 TCCGGGCGGCGGCGGGCGCGGGG - Intergenic
1160822987 19:1067033-1067055 GCCTGACGCTGGCGGGCACGGGG - Intronic
1160930597 19:1568016-1568038 GCCCGACGGCGGCGGGGGCGGGG - Exonic
1161155406 19:2730082-2730104 GCAGGACGTAGGCGGGGGCGGGG - Intronic
1162933044 19:13966674-13966696 GCCTGAGGGCGTCGGGCCCGGGG - Exonic
1165907789 19:39204164-39204186 GCTTGAGGTCGGCGGAGGCGGGG + Exonic
1167156260 19:47741177-47741199 GCTTGCCGTCGGCAGGCGCCAGG - Exonic
1168286874 19:55339678-55339700 GTTTGACGGCGGCGGGGGCGTGG + Intergenic
1168305539 19:55433278-55433300 GTCCGACGCCGGCGGGGGCGGGG - Exonic
924988065 2:288742-288764 GCCTGACGTCGGCGGGCGCGGGG - Intronic
927966893 2:27275880-27275902 GCCTGGCGGGGGCGGGGGCGGGG - Intronic
929604720 2:43226722-43226744 GCCTGACGTCCGCGAGCGGGCGG - Intergenic
937221806 2:120346277-120346299 GGCAGGCGTCGGCGGGGGCGTGG - Exonic
942363037 2:175192719-175192741 GCCTGTCGTGGGCTGGCGGGAGG + Intergenic
945664156 2:212721059-212721081 GGCTGACGAGTGCGGGCGCGTGG - Intergenic
1169088164 20:2840159-2840181 GCGGGACGGCGGCGGGCACGTGG - Intronic
1169191457 20:3661136-3661158 GCCCGGCGGCAGCGGGCGCGGGG + Exonic
1176156937 20:63626796-63626818 GCCTGACGCCGCCGCCCGCGCGG + Intronic
1181017539 22:20080014-20080036 GACTGAGGGCGGCGGCCGCGAGG - Intergenic
1182464422 22:30505648-30505670 GCCAGGCGGCGGCGGGCGGGCGG - Exonic
1185188592 22:49418346-49418368 GCCAGACGGCCTCGGGCGCGTGG - Intronic
954778977 3:53045666-53045688 GCCGGGCGCCGGCGGGCGCGCGG - Intronic
968434070 4:576089-576111 GGCGGGCGGCGGCGGGCGCGCGG - Intergenic
980130687 4:128812784-128812806 GCCTTACTTCGGCAGGGGCGAGG + Intronic
987286862 5:16465869-16465891 GCCTCACGGCGGCGGAGGCGTGG - Intergenic
991351256 5:65722338-65722360 GGCTGGCGGCGGCGGGCGCGTGG - Exonic
1002185939 5:177454857-177454879 CCATGGCGCCGGCGGGCGCGCGG - Exonic
1006180385 6:32150512-32150534 GGCTGGCGCCGGCGGGGGCGGGG + Exonic
1006599130 6:35214203-35214225 GCCGGACGTCGGGGAGAGCGAGG - Intergenic
1019271126 7:149840-149862 GCCTGGCCTCGGCGGGGACGCGG + Intergenic
1019448901 7:1086100-1086122 GCCTGCCCTGGGCGGGCGAGTGG - Intronic
1019984000 7:4641991-4642013 GTCAGAGGTCAGCGGGCGCGGGG + Intergenic
1021313382 7:19117901-19117923 GCCTTCCTCCGGCGGGCGCGGGG + Intergenic
1026899308 7:74028195-74028217 GTCTGACGGCGGCGGCCCCGCGG + Exonic
1027265414 7:76492455-76492477 GCCTGATGACGGTGGGCGCTCGG + Intronic
1027316785 7:76990572-76990594 GCCTGATGACGGTGGGCGCTCGG + Intergenic
1035171226 7:157018379-157018401 GCCGGACTGCGGCGAGCGCGTGG + Intergenic
1038540373 8:28385915-28385937 GCCCGACAGCCGCGGGCGCGCGG + Intronic
1042859185 8:73295626-73295648 GCCTGCCGTGGTAGGGCGCGGGG - Intronic
1049419549 8:142510765-142510787 GCCTGGCGGCGGCGGGCGGACGG + Intronic
1049647081 8:143740295-143740317 ACCTGAGGGCGGCGCGCGCGGGG - Intergenic
1049843203 8:144787246-144787268 GCCCGGCGGGGGCGGGCGCGCGG - Intronic
1056406838 9:86282775-86282797 GCGTGACGTCGGGGAGCGGGCGG + Intergenic
1061666726 9:132164345-132164367 GCTGGACGCCGCCGGGCGCGGGG - Intronic
1061802818 9:133121364-133121386 GTCTGACCTCGGCGAGGGCGGGG - Intronic
1062462009 9:136666056-136666078 CCCTGCCGGCGGCGGGCGGGCGG + Intronic
1062614126 9:137388338-137388360 TCCTCCCGTCGGCCGGCGCGGGG - Intronic
1189274262 X:39773329-39773351 GCCTGGCCTCGGCAGGAGCGAGG - Intergenic
1196684076 X:118495918-118495940 GGCGGACCTCGGCGGGCGGGTGG - Exonic
1197709291 X:129654427-129654449 GCCTGGCGCTGGCCGGCGCGTGG + Intronic