ID: 924988267

View in Genome Browser
Species Human (GRCh38)
Location 2:289430-289452
Sequence CTCTCGCAGGGGGTCTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924988267_924988278 5 Left 924988267 2:289430-289452 CCTCCCCAGACCCCCTGCGAGAG 0: 1
1: 0
2: 1
3: 17
4: 225
Right 924988278 2:289458-289480 GCGAAGGTCCCTCCCCGGCAAGG 0: 1
1: 0
2: 1
3: 4
4: 79
924988267_924988277 0 Left 924988267 2:289430-289452 CCTCCCCAGACCCCCTGCGAGAG 0: 1
1: 0
2: 1
3: 17
4: 225
Right 924988277 2:289453-289475 GACGAGCGAAGGTCCCTCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924988267 Original CRISPR CTCTCGCAGGGGGTCTGGGG AGG (reversed) Intergenic
900469635 1:2847321-2847343 CCCTCCCAGGGGGACTGGTGGGG + Intergenic
900570563 1:3356262-3356284 TTGGCGCAGGGGGGCTGGGGGGG - Intronic
902213512 1:14920588-14920610 ATCTCCCAGGGGGTCTGGGAAGG + Intronic
902304731 1:15527100-15527122 CTCTCGGAGGGCGGCGGGGGAGG + Intronic
902600844 1:17539551-17539573 GGCTCGCAGCGGGTCGGGGGAGG + Intergenic
904343976 1:29856202-29856224 CTCGCACAAGGGGTCTGAGGAGG + Intergenic
904604515 1:31691434-31691456 CTATCCCAGGGGGTCCAGGGAGG + Exonic
909958140 1:81802614-81802636 CTTTCACTGGGGGCCTGGGGAGG + Intronic
913212676 1:116594754-116594776 CTAAAGCATGGGGTCTGGGGAGG - Intronic
914856886 1:151358975-151358997 CTCTCTCAGTGGGTCTGTTGAGG + Intergenic
916008072 1:160679929-160679951 CTGTCACAGTGGGTCTGTGGTGG + Intronic
919802505 1:201362081-201362103 CACCCCCAGGGGGTTTGGGGAGG - Intronic
921731275 1:218581172-218581194 CTCTCCCAGGAGGTCAGGGGTGG + Intergenic
923446891 1:234080095-234080117 CTCTCCCTGGAGGTCGGGGGTGG - Intronic
1062854918 10:775275-775297 CTCTCGCAGGCGGTACTGGGGGG - Intergenic
1063255347 10:4321214-4321236 CTCTCGCATGGGGACTTGGGAGG + Intergenic
1063663824 10:8050425-8050447 CTGTCGCTGTGAGTCTGGGGAGG - Intergenic
1064034211 10:11902104-11902126 CTGACTCAGTGGGTCTGGGGTGG - Intergenic
1069006272 10:63320931-63320953 CTCTCCCTGGAGGTCTGGGGTGG - Intronic
1069658042 10:70104964-70104986 CTGTGGCAGGGGGTCGGGGAGGG + Intronic
1069747286 10:70723827-70723849 CTGTGGCAGGGTGGCTGGGGTGG - Intronic
1069892059 10:71658071-71658093 CTCCCTCAGAGGGGCTGGGGTGG + Intronic
1070141437 10:73741080-73741102 CTCTCAAAAGGGGTATGGGGCGG - Intergenic
1070328177 10:75401216-75401238 CTGGCGCAGGGGGTCAGAGGGGG + Exonic
1070380528 10:75876913-75876935 CTCATTCAGGAGGTCTGGGGCGG + Intronic
1070961922 10:80505382-80505404 CTGTGGCAGGGGTGCTGGGGAGG + Intronic
1071264565 10:83953439-83953461 CTGACTCAGGTGGTCTGGGGTGG + Intergenic
1073945353 10:108743849-108743871 CTCCTGCAGGGGTTGTGGGGAGG - Intergenic
1075723022 10:124598296-124598318 CTGTCTCAGGGGGTCCAGGGTGG + Intronic
1076058349 10:127393533-127393555 CCATCGCAGGGGGCCTGGGATGG - Intronic
1076290420 10:129341349-129341371 CTCTGGAAGGGAGGCTGGGGAGG + Intergenic
1076452588 10:130567027-130567049 CCCGTGCAGGGGCTCTGGGGTGG + Intergenic
1076827149 10:132974790-132974812 CCCTCGAAGAGGGGCTGGGGTGG - Intergenic
1077409871 11:2398996-2399018 CGCTCGCTGGTGGGCTGGGGGGG - Intergenic
1078149601 11:8747589-8747611 CCCACTCTGGGGGTCTGGGGTGG - Intronic
1081563583 11:44241832-44241854 TTCACACAGGGGGTCTGGGTTGG - Intronic
1083609475 11:63998229-63998251 CACAGGCAGGGGGCCTGGGGCGG - Exonic
1084004921 11:66317515-66317537 CTCTTGCATGGGGTTGGGGGTGG - Intergenic
1084332064 11:68436320-68436342 CTCTGGGTGGGCGTCTGGGGAGG + Intronic
1084426836 11:69088720-69088742 GTGTGGCAGGGGGCCTGGGGTGG + Intronic
1085319806 11:75567006-75567028 CTCTTGCAGGGGGTCCTGGGAGG - Intronic
1085752586 11:79174626-79174648 CTCTGGCAGGAGGTGTGAGGAGG + Intronic
1088093957 11:106077150-106077172 CTCTAGGAGGGGGTCTGCAGTGG - Intronic
1089216394 11:116837100-116837122 CGATCCCAGGGGCTCTGGGGGGG + Exonic
1094497136 12:30995386-30995408 CTATTGCTGGGGCTCTGGGGTGG + Exonic
1097793932 12:63843561-63843583 CTCTGGCGGGGGCTCTGGTGGGG - Intergenic
1097902160 12:64883879-64883901 TTCTCACGGGGGGTCGGGGGCGG + Intergenic
1098309439 12:69133562-69133584 CTGTTTCAGCGGGTCTGGGGTGG + Intergenic
1098391296 12:69972218-69972240 CTATTTCAGTGGGTCTGGGGTGG + Intergenic
1099550550 12:84038377-84038399 CTCTCTCAGGGGGCCAGCGGGGG + Intergenic
1101244979 12:102876724-102876746 CTGGGGCAGAGGGTCTGGGGAGG - Intronic
1102029450 12:109731579-109731601 CTCCTGCAGGAGGTCTGGGCAGG - Intronic
1102511091 12:113416021-113416043 CTTGAGTAGGGGGTCTGGGGTGG - Intronic
1103747352 12:123134416-123134438 CTCTTGCAGGAGGTGTGGAGTGG - Intronic
1104727908 12:131088935-131088957 CACATTCAGGGGGTCTGGGGTGG + Intronic
1105751559 13:23425782-23425804 CTCCCGCAGGGAGTCAGGCGGGG - Intronic
1106207848 13:27616154-27616176 CAATTGCAGGGGGTCGGGGGTGG + Intronic
1113786761 13:113006164-113006186 CTCTCGCAGAGGGGCTGGGAGGG - Intronic
1113881313 13:113628423-113628445 CTCTCGCTGGGGAGCAGGGGAGG - Intronic
1113961085 13:114126458-114126480 ATCTTGGAGGGGGTCTGGGAGGG - Intronic
1116080478 14:40164236-40164258 CTCTCGGGGGGGGTGCGGGGGGG + Intergenic
1117508901 14:56429125-56429147 CTCTTGCAGGGAGGTTGGGGTGG + Intergenic
1119609550 14:76050153-76050175 TTCTAGCTGGGGATCTGGGGAGG - Intronic
1119930720 14:78543548-78543570 CTCTTGGTGGGGGTCTGTGGAGG + Intronic
1121269986 14:92631555-92631577 CTGACTCAGTGGGTCTGGGGTGG + Intronic
1125728911 15:41882146-41882168 CTGTGGGAGGGGGTCGGGGGTGG + Intronic
1128541620 15:68538750-68538772 CTCTCCCAGTAGGTCTGGGGAGG - Intergenic
1131385595 15:92004083-92004105 CTCTCCCAGAAGGTCTGGGTGGG - Intronic
1131536080 15:93239189-93239211 CTGTCGCAGTAGGTCTGGGGAGG - Intergenic
1132522910 16:399615-399637 CTCTCGCTGCAGGTCTGGGAAGG + Exonic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1133002341 16:2857677-2857699 CTGCCGCAGGAGGTCAGGGGAGG - Intronic
1133967730 16:10543809-10543831 CTGACTCAGGAGGTCTGGGGTGG + Intronic
1135607605 16:23836974-23836996 CTCTGGGAGGGGGACTGGGAAGG - Intronic
1136173366 16:28501932-28501954 CTTTCCCACGTGGTCTGGGGTGG + Intronic
1136394236 16:29984203-29984225 CCCTCCCAGGGGGGCTGGGAGGG - Intronic
1136857935 16:33676186-33676208 CTCTGTCAGGGGGGGTGGGGGGG + Intergenic
1137756482 16:50906369-50906391 CTGTCACAGGGAGGCTGGGGAGG + Intergenic
1140304946 16:73794285-73794307 GGCTGGGAGGGGGTCTGGGGTGG - Intergenic
1142246033 16:88970471-88970493 CTCACACAGCGGGGCTGGGGTGG - Intronic
1142888920 17:2930284-2930306 CTGGGGCTGGGGGTCTGGGGAGG + Intronic
1143446373 17:7012593-7012615 CCCTCGCAGGGGGGCAGAGGGGG - Exonic
1143514322 17:7411740-7411762 GTCTCCCAGGGGCTCTGGGTGGG + Intronic
1143749837 17:9020705-9020727 CTGCCTCAGGGGATCTGGGGAGG + Intergenic
1144686351 17:17228623-17228645 CTCCTGCAGGGGGTCGGCGGGGG + Intronic
1144729389 17:17517906-17517928 CTCTGGAAGGTGGTCTGGGTGGG - Intronic
1144783668 17:17820187-17820209 CCCTGGCAGGGGCTGTGGGGTGG + Exonic
1146260438 17:31417037-31417059 CAAACGCAGGGGGTCTGGGGTGG - Intronic
1146927169 17:36753170-36753192 GTCTCGCAGAGCGCCTGGGGTGG - Intergenic
1147256816 17:39186496-39186518 CACTGGCAGGGGGTGTGGGGCGG + Exonic
1147458689 17:40554691-40554713 CTCTCCCAGGGTCCCTGGGGTGG - Exonic
1147605264 17:41770708-41770730 CTCTCCCAGAGGGGCAGGGGAGG + Intronic
1147890513 17:43713612-43713634 CGCTGGCATGGGGACTGGGGAGG - Intergenic
1148063291 17:44851108-44851130 CTCTCACTGGGGCTCTGGGTTGG + Exonic
1148691306 17:49528458-49528480 CACGCACAGGGGGTCAGGGGTGG + Intergenic
1148842477 17:50508144-50508166 CCCTCACAGCGGTTCTGGGGGGG - Intergenic
1149614803 17:57988420-57988442 CCCCCGCGGGGGGGCTGGGGTGG + Intergenic
1150143609 17:62750310-62750332 CTCGGGCACGGGGTCCGGGGAGG + Intronic
1150329378 17:64282698-64282720 CTGACGCAGGCGGTCGGGGGTGG + Intergenic
1151183774 17:72349064-72349086 CTATGGCACGGGCTCTGGGGAGG - Intergenic
1152026693 17:77814294-77814316 CTGGCGCTGGGGCTCTGGGGTGG - Intergenic
1152178629 17:78803763-78803785 TTCTCAGAGGGGCTCTGGGGGGG + Exonic
1152600366 17:81259248-81259270 CTCTGGCTGGGGGTCTCAGGCGG - Intronic
1155341287 18:24817046-24817068 CTGATTCAGGGGGTCTGGGGTGG + Intergenic
1160534819 18:79586154-79586176 CTCTCCCGGGGTGTCTGGAGGGG + Intergenic
1160631145 18:80247193-80247215 CCCGCGGAGGGGGACTGGGGCGG - Intronic
1160896923 19:1407518-1407540 CTCCCGCACGGGGTCTCCGGGGG - Intergenic
1160923482 19:1531738-1531760 CTCTCCCAGGGGGTCCTGTGTGG - Exonic
1160944586 19:1635497-1635519 CTCAGGCAGGGGGTGTGGGTGGG - Intronic
1161248869 19:3270137-3270159 CTCTCCCATGGGGTCAGGGTTGG - Intronic
1161319187 19:3633213-3633235 CCCTGGCAGGGGGCCTGGGGTGG - Intronic
1163607338 19:18282180-18282202 GGCTCGCCGGGGGTGTGGGGAGG + Intergenic
1163613237 19:18311656-18311678 CTGTCGGAGGGCGTCTGGGTGGG - Intronic
1166633608 19:44429745-44429767 CTCCCACAGGGGCTCTGGGGTGG + Exonic
1166976752 19:46609427-46609449 CTCCCCAAGGGGATCTGGGGAGG - Exonic
1167374585 19:49104013-49104035 CACTCCCAGGGGGCCTGGCGGGG - Intronic
1167383908 19:49153194-49153216 CTGTCCCAGGGGCCCTGGGGTGG - Intronic
1167594228 19:50418815-50418837 CTCAGGGAGGGGGTCAGGGGAGG - Intronic
924988267 2:289430-289452 CTCTCGCAGGGGGTCTGGGGAGG - Intergenic
925007840 2:458608-458630 CTCTCCCAGGGGCTGGGGGGAGG + Intergenic
925847145 2:8044368-8044390 TTCTCACTGGGGGTGTGGGGTGG - Intergenic
926563670 2:14445537-14445559 CTCTGGCAGGGGGTTGGTGGGGG + Intergenic
926699805 2:15796204-15796226 CTGTCTCAGGTGGTCTTGGGTGG - Intergenic
927248513 2:20977787-20977809 CTCTCCGAGGGGGGCTGGAGGGG - Intergenic
929806949 2:45154308-45154330 GTCTGGCAGGAGGCCTGGGGAGG - Intergenic
930136273 2:47906239-47906261 CTCTTTCAGGGGGTGTGGGGGGG - Intergenic
931882393 2:66581474-66581496 CCCCGGCAGGGCGTCTGGGGAGG - Intergenic
933285480 2:80380415-80380437 CTCCCGCAAGGGCTCTGAGGAGG + Intronic
934892950 2:98086933-98086955 CTCTGTTTGGGGGTCTGGGGTGG + Intergenic
937123648 2:119458812-119458834 CTGAGGCAGTGGGTCTGGGGTGG - Intronic
938383143 2:130847883-130847905 CTCTCAGAGGGGCTGTGGGGAGG - Intronic
940311204 2:152280323-152280345 CTCTCCCATGGTGTCTGTGGAGG + Intergenic
941711448 2:168718416-168718438 CTCACTCAGTGGGCCTGGGGTGG - Intronic
941906226 2:170717425-170717447 CTCTCGCAGAGGTGCTGGGAAGG - Exonic
944676410 2:202036396-202036418 CTCTTGCAAGAGGGCTGGGGTGG - Exonic
946170520 2:217892726-217892748 CTCTATCAGGGGTTCTGGTGGGG - Intronic
946560667 2:220908901-220908923 CTATCTCATGGGGTTTGGGGGGG - Intergenic
948509977 2:238457718-238457740 CTCTGGCAAGGGCTCTGGGCAGG - Intergenic
948540844 2:238690587-238690609 CCTTCTCAGGGGGTCTGGCGGGG - Intergenic
948764263 2:240211524-240211546 CTCCAGCAGGGGGTGTGGTGTGG + Intergenic
949018983 2:241730203-241730225 TGCTGGCTGGGGGTCTGGGGAGG + Intergenic
1168819155 20:761714-761736 CTCTTGCAGGGCCACTGGGGTGG - Exonic
1169140211 20:3223485-3223507 CTCAGGCCGGGGATCTGGGGAGG + Exonic
1170731307 20:18978325-18978347 CCATGGCAGGGGGTGTGGGGAGG - Intergenic
1171201825 20:23247931-23247953 CTTTCACAGGGGCTCTGGGTGGG - Intergenic
1172520915 20:35564956-35564978 CTCCAGGAGGTGGTCTGGGGAGG + Intergenic
1172649513 20:36492982-36493004 CACTGGCAGGGAGTCTGGGCTGG - Intronic
1172767557 20:37358848-37358870 CTCTGCCAGTGGGGCTGGGGTGG - Intronic
1173616120 20:44403937-44403959 CTCTCCCCGGGGGTCGGGGGAGG + Intronic
1174547746 20:51338526-51338548 CTCTCTCATGGGGTCTGGATCGG - Intergenic
1174648594 20:52105703-52105725 CTGACTCAGTGGGTCTGGGGTGG + Intronic
1175163968 20:57029931-57029953 CTGTCGCAGAGAGTCTGGGATGG + Intergenic
1175786226 20:61713316-61713338 TCCTTGCAGGAGGTCTGGGGGGG - Intronic
1175810111 20:61853246-61853268 CTCCCGGAGTGGGACTGGGGTGG + Intronic
1175975196 20:62707542-62707564 CTCTCCCAGGGGTTCTGGGGAGG + Intergenic
1176286072 21:5020344-5020366 CTCTCTCGGGGGGGCGGGGGGGG + Intergenic
1176973088 21:15288929-15288951 CTCTGTCAGGGGGTGAGGGGAGG + Intergenic
1179185898 21:39085103-39085125 CTGACTCAGGAGGTCTGGGGTGG - Intergenic
1179238691 21:39569404-39569426 CCAGGGCAGGGGGTCTGGGGTGG - Intronic
1179871109 21:44243131-44243153 CTCTCTCGGGGGGGCGGGGGGGG - Intergenic
1179882912 21:44300764-44300786 TTTTCGCAGGGGTACTGGGGAGG + Intronic
1181107092 22:20581973-20581995 CTCTCCCAGGGGCGCTGGTGTGG + Intronic
1181172146 22:21015772-21015794 CTCATTCAGGGGGTCTGGAGTGG + Intronic
1183590408 22:38776401-38776423 CTCTCACTAGGGGGCTGGGGAGG - Intronic
1185275396 22:49948377-49948399 CTTTCTCAGGGTGTCTGGGTTGG + Intergenic
949893262 3:8749060-8749082 CTCAGGCATGGGGTCTGGGGAGG + Intronic
950054106 3:10011549-10011571 CTCTGGCGGCGGGTGTGGGGGGG - Intergenic
950262941 3:11555208-11555230 CTCCCGCAGTGGCTCTGGGCAGG - Exonic
951656132 3:25010640-25010662 CTCTCACAGGGGTACTGTGGGGG - Intergenic
952959322 3:38579742-38579764 CCCTTCCAGGGAGTCTGGGGAGG - Intronic
955446508 3:59016729-59016751 TTCTCTCAGTAGGTCTGGGGTGG + Intronic
956721319 3:72120516-72120538 CTATCCCAGGGGATGTGGGGAGG + Intergenic
962808459 3:138943166-138943188 CTCTCGCAGGATGCCTGTGGGGG + Intergenic
964878784 3:161400393-161400415 CTGTCGGAGGGGGTTGGGGGAGG + Intergenic
967493652 3:190120427-190120449 CCCTCGCCGGGGGGCGGGGGCGG + Exonic
968815138 4:2818163-2818185 CTCTCGGCGGGGGACTGGGCGGG - Exonic
968921069 4:3522597-3522619 CCCAGGCAGGGGGTGTGGGGCGG - Intronic
968921082 4:3522631-3522653 CCCAGGCAGGGGGTGTGGGGCGG - Intronic
968921096 4:3522665-3522687 CCCAGGCAGGGGGTGTGGGGCGG - Intronic
968921109 4:3522699-3522721 CCCAGGCAGGGGGTGTGGGGCGG - Intronic
971175611 4:24279705-24279727 CCCTTGCAGGGGGACTGCGGAGG - Intergenic
975445822 4:74463942-74463964 CTCTTTCAGGGGGTCAGGTGAGG + Intergenic
979105872 4:116686340-116686362 CTCTAGCAGGGACTCTGGCGTGG - Intergenic
980510445 4:133779748-133779770 CCCTAGCAGGGGGTGGGGGGCGG - Intergenic
983074868 4:163313970-163313992 TGCTGGCAGGGGGTCAGGGGAGG - Intergenic
983525936 4:168760310-168760332 CTCTGGCAGTGGGTGCGGGGAGG + Intronic
984961157 4:185100031-185100053 CTCTGCCTGGGGCTCTGGGGAGG + Intergenic
988647490 5:33110267-33110289 CTGTTGCAGGGGGTCGGGGGAGG - Intergenic
1000586332 5:163103442-163103464 AGCTCGCAGGGGGTCTGGTCTGG + Intergenic
1002077853 5:176719890-176719912 CACTGGCAGGGGTTCTGGTGAGG + Intergenic
1002181526 5:177433419-177433441 CTCTCCCAGGGGCTCTGGCCTGG - Intronic
1002548901 5:179972513-179972535 ATCCCGCTGGGGGTCGGGGGAGG + Intronic
1003683368 6:8277636-8277658 CTGGGGCAGGGTGTCTGGGGAGG + Intergenic
1004461779 6:15843306-15843328 CTCACTGAGGGGGTCTAGGGTGG + Intergenic
1006071349 6:31499574-31499596 CTCTCCTTGGGGGTCTGGAGGGG - Intronic
1006660836 6:35642635-35642657 CTTTCTGAGGGGGGCTGGGGTGG - Intronic
1006914468 6:37585473-37585495 ACATCCCAGGGGGTCTGGGGAGG - Intergenic
1012259795 6:97074236-97074258 CTGTTTCAGGAGGTCTGGGGAGG + Intronic
1012563101 6:100611072-100611094 CTCTGGCAGAAGGTCTGGTGAGG + Intronic
1013110570 6:107061712-107061734 CTGATGCAGAGGGTCTGGGGTGG - Intergenic
1013582647 6:111551510-111551532 CTCTCAGATGGGTTCTGGGGTGG - Intergenic
1018066845 6:160130675-160130697 CTCTGGAAAGGGGTCTGGGCTGG + Intronic
1022652992 7:32294077-32294099 CTCTCAGAGGGGATCTGGGCAGG - Intronic
1022973535 7:35537438-35537460 AGCACGCGGGGGGTCTGGGGAGG + Intergenic
1025996283 7:66529525-66529547 CTCTCACAGAGGGACAGGGGAGG + Intergenic
1027244562 7:76358582-76358604 CTCACTGAGGGGGGCTGGGGAGG - Intronic
1028424826 7:90674771-90674793 CTGTCCCAGGAGGTCTGGAGTGG - Intronic
1029644624 7:101846042-101846064 CTGTCTCAGGAGGCCTGGGGTGG - Intronic
1030704235 7:112674752-112674774 CTGTAGCAGTGGGTGTGGGGTGG + Intergenic
1032716462 7:134513031-134513053 CTGACTCAGAGGGTCTGGGGTGG + Intergenic
1033652855 7:143355355-143355377 CTCTGGTAGGAGGCCTGGGGAGG + Exonic
1035185265 7:157121347-157121369 CTCTCTCAGGGCCTCTGGCGAGG + Intergenic
1035773603 8:2170207-2170229 GTCTTGCAGGGGCTGTGGGGAGG + Intergenic
1037855208 8:22366976-22366998 CTCCTCCAGGGGGTGTGGGGTGG + Intergenic
1037886731 8:22599579-22599601 CACTCCCAGCGGGGCTGGGGGGG - Intronic
1038295914 8:26291241-26291263 CTAGCGCCGGGGCTCTGGGGCGG - Intergenic
1038384918 8:27134806-27134828 CTCTGGCATGGTGTCTGTGGAGG - Intergenic
1039390683 8:37178818-37178840 CACGCACACGGGGTCTGGGGAGG + Intergenic
1042215723 8:66428710-66428732 GTCTCGCAGGCGGTCTAGAGAGG - Intergenic
1043522641 8:81063146-81063168 CTCTCCCAGTGGGCCTGGGCAGG + Intronic
1043536582 8:81211618-81211640 CTCTCACAGGGGTTGTGGTGAGG + Intergenic
1045055462 8:98364417-98364439 CTCTCACACTGGGTCTCGGGAGG + Intergenic
1046837618 8:118820652-118820674 CTCTCTCTTGGGGTCTGGGTCGG - Intergenic
1048868864 8:138780947-138780969 CTCTCCCAGGGGGGCCGGGCAGG + Exonic
1048986480 8:139737628-139737650 CTCTCCCAGGCGGGATGGGGCGG + Intronic
1049429032 8:142550727-142550749 CTCTCCCAGGGGTTCCGGGTTGG + Intergenic
1049757334 8:144316502-144316524 CTCTGGCAGCGGGTGTGAGGTGG + Exonic
1057875192 9:98748123-98748145 CTCTGGCAGAGGGTCTGGCAGGG + Intronic
1059367399 9:113797209-113797231 CTCTCCCAGGTATTCTGGGGTGG + Intergenic
1060676243 9:125517732-125517754 CTCACGAATGGGCTCTGGGGAGG + Intronic
1061973728 9:134057986-134058008 CTCTCGCAGGGCCTCTGTGTCGG - Intronic
1185468951 X:371265-371287 CTCTCACCGTGGGTCCGGGGAGG - Intronic
1185619519 X:1444915-1444937 CTGTTGCAGGGGGTCAGAGGTGG - Intronic
1186430301 X:9499225-9499247 CTCTTTCAGGGGTTCTGGGAAGG - Intronic
1186461730 X:9753666-9753688 CTCTCGCTGGGGGGCTGTGAGGG - Intronic
1187241816 X:17520941-17520963 CTGACTCAGTGGGTCTGGGGTGG - Intronic
1187378426 X:18778519-18778541 TTCTCCCAGGTGATCTGGGGAGG + Intronic
1188506406 X:30889174-30889196 CTCCCGCGGGGGGTCCGGGCCGG + Intronic
1189767662 X:44388601-44388623 CTCTCATATGGGGGCTGGGGTGG + Intergenic
1190050399 X:47145110-47145132 CGTTCGCAAGGGGTGTGGGGAGG + Exonic
1190484810 X:50913758-50913780 CTCTAGCAGGCTGTCTGGGGAGG - Intronic
1195065164 X:101233431-101233453 CTCTTTCTGGGGTTCTGGGGTGG - Intronic
1198724991 X:139667609-139667631 CTGTCTCAGGGGGTGTGGGCAGG + Intronic
1200073340 X:153539537-153539559 CACTCACAGTGGGTCTGGGAAGG - Intronic