ID: 924989703

View in Genome Browser
Species Human (GRCh38)
Location 2:302123-302145
Sequence GTGAAGAAGCTGCATAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924989698_924989703 25 Left 924989698 2:302075-302097 CCAGAGCAAGGCCTCTAATTCTT No data
Right 924989703 2:302123-302145 GTGAAGAAGCTGCATAAGGAAGG No data
924989699_924989703 14 Left 924989699 2:302086-302108 CCTCTAATTCTTTTCATTTCTGT No data
Right 924989703 2:302123-302145 GTGAAGAAGCTGCATAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924989703 Original CRISPR GTGAAGAAGCTGCATAAGGA AGG Intergenic
No off target data available for this crispr