ID: 924993426

View in Genome Browser
Species Human (GRCh38)
Location 2:336190-336212
Sequence TAGAGCCCCCAAAAGAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 256}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924993423_924993426 13 Left 924993423 2:336154-336176 CCAGATGCTGGAGAAGGGAAGGA 0: 1
1: 0
2: 11
3: 150
4: 854
Right 924993426 2:336190-336212 TAGAGCCCCCAAAAGAAGCAGGG 0: 1
1: 0
2: 1
3: 27
4: 256
924993421_924993426 16 Left 924993421 2:336151-336173 CCTCCAGATGCTGGAGAAGGGAA 0: 1
1: 2
2: 11
3: 156
4: 919
Right 924993426 2:336190-336212 TAGAGCCCCCAAAAGAAGCAGGG 0: 1
1: 0
2: 1
3: 27
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924993426 Original CRISPR TAGAGCCCCCAAAAGAAGCA GGG Intergenic
902359151 1:15932613-15932635 GAGAGTCCCCAAAAGGAGGATGG + Exonic
902826922 1:18981272-18981294 TAGAGCCTCCAAAGAAAGCATGG + Intergenic
905388056 1:37617915-37617937 TAGTGGACCCAAAAGAAGGAGGG + Intronic
906659945 1:47574946-47574968 TAGAGCCACCAAAGGACGCACGG - Intergenic
907111088 1:51927179-51927201 TTGAGCACCTAAAATAAGCAAGG + Intronic
908498334 1:64717881-64717903 TAGAGCCTTCAGAAGAAGCATGG - Intergenic
909465136 1:75964886-75964908 TAGAGCCTTCAGAGGAAGCATGG - Intergenic
916374169 1:164133836-164133858 TAGAGCCTCCAGAGGGAGCATGG + Intergenic
917134651 1:171777948-171777970 TAGAGCCTCCAGAAGAAATACGG - Intergenic
917475956 1:175369323-175369345 TAGAGCCTTCAGAGGAAGCATGG - Intronic
918266202 1:182844402-182844424 TTGAGCCCCAAAAAGAAAAAAGG - Intronic
918707706 1:187688882-187688904 TAGAGCCTCCAGAGGAAGCATGG - Intergenic
919319117 1:196011991-196012013 TAGAGCCTTCAGAAGAAGTATGG - Intergenic
920706738 1:208256740-208256762 TAGAGCTTTCAAAAGAAGCCTGG - Intergenic
920820186 1:209373300-209373322 TATTGCTCCCAAGAGAAGCAGGG + Intergenic
920844645 1:209583782-209583804 TAAAGCCAAGAAAAGAAGCAGGG - Exonic
920864331 1:209739134-209739156 TTGGGCCACCAAGAGAAGCAGGG - Intergenic
922590474 1:226772035-226772057 TAGATCCCCCATAAGAAAGATGG + Intergenic
922600196 1:226845331-226845353 TAGAGCCTCCAACAAGAGCAAGG + Intergenic
923670518 1:236036806-236036828 GAGAGCCCCCACCAGAAACAAGG + Intronic
1063859679 10:10293913-10293935 TCGAGCATCCAAAAGAGGCAAGG - Intergenic
1066250083 10:33624796-33624818 TACAGGCCACACAAGAAGCATGG + Intergenic
1068020882 10:51582243-51582265 TAGAGCCCCAAGAACAAGCACGG - Intronic
1068345303 10:55770105-55770127 TAGAGCCACCAGAGGAAGTAAGG + Intergenic
1069832545 10:71289991-71290013 TGGAGCTCCCAAAGGAAGCAAGG + Intronic
1071252238 10:83831004-83831026 TGGAAACCCCCAAAGAAGCAGGG + Intergenic
1071837712 10:89435906-89435928 AAGAGCCCCCAAAACCATCATGG - Intronic
1074249972 10:111735268-111735290 CAGAACCTCCAGAAGAAGCATGG - Intergenic
1076157154 10:128212775-128212797 TAGAGGCCTCAGAGGAAGCAAGG + Intergenic
1076444310 10:130501492-130501514 TAGAGCCTCCAGAGGGAGCATGG - Intergenic
1077737822 11:4809821-4809843 TAGAGCTCCCAGAAGCAGGAAGG - Intronic
1078807898 11:14725127-14725149 TAGATACCTCAAAAGTAGCATGG - Intronic
1079142456 11:17821156-17821178 TAGAGCCTCCAGAGGGAGCATGG + Intronic
1081501155 11:43667968-43667990 TACAGCCCTCAAAAGCACCAAGG - Intronic
1083434651 11:62634130-62634152 GGGAGCCCCCAGAAGAAGGAAGG - Intronic
1083600029 11:63941097-63941119 TTGAGGCCCTAAAGGAAGCAAGG - Intronic
1084679229 11:70656395-70656417 GACAGCCCCCGAGAGAAGCAGGG - Intronic
1085649738 11:78257027-78257049 TAGGGCCCTAAAAAGAAGCCAGG - Intronic
1087086538 11:94224926-94224948 TAGAGCCCTCAGAGGAAGCATGG - Intergenic
1088070261 11:105775004-105775026 TAGAGCCTCCAGAAGGAGCTTGG - Intronic
1088323922 11:108582730-108582752 TAGTGCCCCCAGAGGGAGCATGG - Intronic
1089108530 11:116035900-116035922 CAGAACCTCCAAAATAAGCAGGG + Intergenic
1089966627 11:122658943-122658965 TAGAGCCTCCAGAGGGAGCACGG - Intronic
1091011793 11:132008075-132008097 TTCAGGCCCCAAATGAAGCAAGG + Intronic
1091497128 12:982401-982423 TAAAGCAACCAAAAGAAGCTAGG + Intronic
1091908343 12:4207843-4207865 TACAGCCCCATCAAGAAGCAAGG + Intergenic
1094794249 12:33951832-33951854 TACAGGCCCCACAGGAAGCATGG - Intergenic
1094841278 12:34343634-34343656 TAGGGCCGCCCAAAGAGGCAGGG + Intergenic
1094842394 12:34347603-34347625 GGGAGCCGCGAAAAGAAGCAGGG - Intergenic
1095106099 12:38234446-38234468 TAAAGGCCCCACAGGAAGCATGG - Intergenic
1095417181 12:41989790-41989812 TACAGCCCCCAGAGGAAGTATGG + Intergenic
1097545099 12:60989113-60989135 TAGAGCCTTCAGAGGAAGCATGG - Intergenic
1098297922 12:69022977-69022999 TAGAGACCCCAAAGGAAAAAGGG - Intergenic
1098946084 12:76591329-76591351 TAAAGCCCCCAAAAGATCAAAGG + Intergenic
1100971506 12:100075941-100075963 TGGAGACCCCAAAAGGAGGATGG + Intronic
1102096555 12:110245988-110246010 TAGAGCCTCCAGAAGGAACACGG - Intergenic
1104230795 12:126882043-126882065 TAGAGGACCTAAAAGAAGCTGGG - Intergenic
1104493662 12:129216572-129216594 TAGAGCCTCCAGAGGGAGCATGG + Intronic
1108041321 13:46341756-46341778 AAGACACCACAAAAGAAGCAGGG + Intergenic
1108921995 13:55687510-55687532 TAGAGTCACCAAAAGGAGCGTGG - Intergenic
1109423247 13:62140772-62140794 AATAGCCTCCAAAAGAAGGAAGG + Intergenic
1111611719 13:90615061-90615083 TATAGGACCCAAAAGAACCATGG - Intergenic
1111865977 13:93769449-93769471 GACAGCCCCAAAAAGCAGCAGGG + Intronic
1112143570 13:96673028-96673050 TAGAGCCCCTGGAAGGAGCATGG - Intronic
1116437742 14:44913111-44913133 TAGAGCCCATAAAGGCAGCACGG - Intergenic
1117158456 14:52964011-52964033 TAGAGCCACAAGAAGAGGCAGGG - Intergenic
1117189345 14:53275371-53275393 TACAGAACCCAAAAGAACCATGG - Intergenic
1119033422 14:71210293-71210315 TAGAGCCCCCATAAAATGAAAGG - Intergenic
1120292918 14:82600149-82600171 TAGAGCCTTCAAAGGCAGCATGG - Intergenic
1123398015 15:19956141-19956163 GTGGGACCCCAAAAGAAGCAGGG - Intergenic
1126140822 15:45437195-45437217 CAGAGCCACCTAAAGTAGCATGG + Intronic
1127556891 15:60096309-60096331 TAAAGCCTCCAGAAGGAGCATGG - Intergenic
1128915039 15:71552089-71552111 TAGAGCCCCAGAAATAAGAAAGG + Intronic
1129061491 15:72863917-72863939 TAGAGCCCTCAGAGGTAGCATGG + Intergenic
1129450509 15:75648614-75648636 GAGAGCCGCCAAAAGAATCTGGG + Exonic
1129522775 15:76196245-76196267 GAGACACCCCAGAAGAAGCAGGG - Intronic
1129532829 15:76282361-76282383 TAGAGCCCCCAGAGGGAGTATGG + Intronic
1129650500 15:77483949-77483971 TTGAGCTCACAAAAAAAGCAAGG + Exonic
1129904554 15:79177110-79177132 TAGAGCCTTCAGAGGAAGCATGG + Intergenic
1130887928 15:88109426-88109448 TGAAGCTCCTAAAAGAAGCAGGG + Intronic
1132284749 15:100654681-100654703 ACGAGCCCCCAAAGGAGGCAGGG + Intergenic
1133189485 16:4122948-4122970 TAGAACCTTCAAAAGAAGCGTGG + Intergenic
1133517578 16:6524695-6524717 TAGAGCCCTCACAGGGAGCATGG - Intronic
1134322463 16:13176230-13176252 TAGACCCCCCAAAATATGCCTGG - Intronic
1137036828 16:35575239-35575261 CAGGGCCCCCAGAGGAAGCAGGG + Intergenic
1137976291 16:53035087-53035109 TAGAGTCTTCAAAGGAAGCATGG - Intergenic
1140740165 16:77934486-77934508 TAGAGCCTCCAGAAGGAACATGG + Intronic
1141086626 16:81100311-81100333 TAGAGCCCTCAGAGGGAGCATGG + Intergenic
1141285061 16:82663754-82663776 AAGAGCCCACATAAGAACCAAGG + Intronic
1141437637 16:84009456-84009478 TAGAGCCCACAGAGGGAGCATGG + Intergenic
1141674739 16:85511815-85511837 TAGAGCCTCCAGAGGGAGCAGGG + Intergenic
1141896462 16:86961812-86961834 TAGAGCCACCGCAGGAAGCACGG - Intergenic
1142075574 16:88115723-88115745 CAGAGCCCCCAGAAGGAGTACGG - Intronic
1142947608 17:3445967-3445989 TAGAGCCTCCAAAAGGAACATGG - Intronic
1145408315 17:22630786-22630808 TAGAGCCATCAGAAGAAGTACGG + Intergenic
1147613020 17:41812588-41812610 AAGTGCCCGCGAAAGAAGCAAGG + Exonic
1148142747 17:45339944-45339966 CAGAGACCCCAACAGCAGCAAGG + Intergenic
1148518452 17:48244870-48244892 TAGAACCTCCAAATGATGCATGG + Intronic
1148529433 17:48375149-48375171 TACATCCCCCAAAAGAACCCGGG - Intronic
1150604365 17:66678270-66678292 TAGAGCCTCCAGAAGGAACATGG + Intronic
1151243641 17:72777651-72777673 TAGAGCCTTCAGGAGAAGCATGG + Intronic
1151271822 17:73002803-73002825 TAGAGCCTCCAGAGGGAGCATGG - Intronic
1203167865 17_GL000205v2_random:114542-114564 ATGAGGCCCCAAAAGAGGCAGGG - Intergenic
1153346984 18:4037575-4037597 AAGAGCCCCCAAAAGAGAAAAGG - Intronic
1154218474 18:12432567-12432589 TCGTGCCCCCAAAATACGCAGGG - Intergenic
1155832916 18:30540711-30540733 TGGAGCCACCAAAAGAGACATGG + Intergenic
1157285512 18:46374733-46374755 TACAGCACACAAAAGCAGCAAGG + Intronic
1160113919 18:76059132-76059154 TAGAGCCCCCATGAGAAGCAGGG + Intergenic
1165120628 19:33556390-33556412 TGGAAACCCTAAAAGAAGCAGGG + Intergenic
1166534005 19:43560581-43560603 TAGAGCCTCCAGAAGGAACAGGG + Intronic
1168280062 19:55300883-55300905 TAGAGCCTCCAGAGGAAGCAGGG - Intronic
1168387338 19:55975314-55975336 TAGTTCTCCAAAAAGAAGCAGGG + Intronic
1168434892 19:56309109-56309131 TTCAGCCCCCAAAAGAGGAATGG + Intronic
924993426 2:336190-336212 TAGAGCCCCCAAAAGAAGCAGGG + Intergenic
925749897 2:7078578-7078600 TAGATCCCCCAAAGAAATCAGGG - Intergenic
926558324 2:14386712-14386734 AAAACCCTCCAAAAGAAGCAAGG + Intergenic
926886104 2:17600282-17600304 AAGAGCCCACGAAATAAGCAAGG - Intronic
926957831 2:18320966-18320988 GAGAGAACACAAAAGAAGCATGG - Intronic
927433196 2:23044264-23044286 TAGAGCCCCCAGAAGGAGTGTGG + Intergenic
927457628 2:23270379-23270401 TGTAGCCCATAAAAGAAGCAGGG - Intergenic
927642952 2:24857007-24857029 AACAGGCCCCAAGAGAAGCAGGG + Intronic
928694486 2:33835308-33835330 TAAAGCCCCCAGAAAATGCAGGG - Intergenic
929681571 2:43997459-43997481 CCAAGCCCCCAAAAGAAACAAGG + Intergenic
929797192 2:45069206-45069228 TAGAGGCCCAGAAAGCAGCATGG + Intergenic
929858763 2:45657525-45657547 TATAGCCCCCAAAATGAGCATGG + Intronic
930306611 2:49682642-49682664 GAGTGCCCCGAAAAGGAGCAGGG - Intergenic
932860972 2:75290917-75290939 TAGAGCCTCCAGAGGGAGCACGG - Intergenic
936234124 2:110729048-110729070 TAGAGCCTTCAAAAGTAACAAGG + Intergenic
937996379 2:127697793-127697815 GAAAGCCCTCAAAAGAAGCGTGG + Intergenic
939932793 2:148255279-148255301 TACAGCACCCAAAGGAACCACGG - Intronic
940645731 2:156391116-156391138 GGGGGCCCCAAAAAGAAGCAAGG - Intergenic
941003012 2:160221251-160221273 GTGAGACCCCAAAGGAAGCAGGG - Intronic
941152423 2:161931287-161931309 GAAAGTCCCCAAAAGAAGCTAGG - Intronic
942241886 2:173970489-173970511 TAGAGCCACAGAGAGAAGCAAGG + Intergenic
943002402 2:182345034-182345056 TTTAGCCCCCAAAACAAGCCAGG - Intronic
944068686 2:195646521-195646543 TAGAGCCTCCAGAAGAAACGTGG - Intronic
946598144 2:221329103-221329125 TTGGGCCGCCAAAAGAACCAAGG + Intergenic
948654971 2:239470916-239470938 TGGAGCCCCCAAAACAGTCAAGG - Intergenic
1169238258 20:3950467-3950489 TAGAGCCTTCAGAGGAAGCATGG + Intronic
1172046718 20:32085714-32085736 AAGACCCACCAAATGAAGCAGGG + Intronic
1174710791 20:52702944-52702966 TAGAGCAGCAAAAAGAAACAAGG - Intergenic
1174735526 20:52962294-52962316 GAGAGCAACCAAAAGAGGCATGG + Intergenic
1175056251 20:56201337-56201359 TAGAGCTTCCACAAAAAGCATGG + Intergenic
1175577948 20:60076713-60076735 TAAAGCCCCCAGAAATAGCAAGG - Intergenic
1175694156 20:61088770-61088792 TGGAGCCCAAAAGAGAAGCAGGG - Intergenic
1176403892 21:6344594-6344616 ATGAGGCCCCAAAAGAGGCAGGG + Intergenic
1176433265 21:6644510-6644532 ATGAGGCCCCAAAAGAGGCAGGG - Intergenic
1177409203 21:20708032-20708054 TAAAGCCAGGAAAAGAAGCAAGG - Intergenic
1177571861 21:22897617-22897639 TAAAGCCTTCAAAGGAAGCATGG - Intergenic
1181411027 22:22719891-22719913 TAGAGCTCCCACAAGAAGATAGG - Intergenic
1182153430 22:28047536-28047558 TAAAGCGCCCACAAAAAGCAAGG + Intronic
1182805008 22:33062023-33062045 AAAATCCCCCAAAAGAAACATGG - Intergenic
1184880102 22:47299280-47299302 TAGAGACCCAAAAAGCAGAAAGG - Intergenic
949736100 3:7173399-7173421 TAGGGCCACCAAAAGAGGGATGG - Intronic
950496020 3:13335066-13335088 TAGAGCACCCAACAGAGGCTGGG - Intronic
951658229 3:25033208-25033230 TAGAGCTTTCAAAAGAAACAAGG + Intergenic
952889866 3:38032539-38032561 TGCAGCCCTCAAAAGCAGCAGGG - Intergenic
953785772 3:45910143-45910165 TAAAGCCCCCAGGAGAAGAAGGG + Intronic
954797151 3:53167304-53167326 TAGAGCCCCCCAAAAAGGCCTGG - Intronic
956032144 3:65050107-65050129 TAGAGTCTCCAAAGGGAGCATGG - Intergenic
956116320 3:65922564-65922586 TAGATCCTTCAAAGGAAGCAAGG + Intronic
956399438 3:68861552-68861574 TAAAGACCACAAAAGATGCATGG + Intronic
956532525 3:70236554-70236576 TACAGGCCCCAAAAGGAGTATGG - Intergenic
957429624 3:80085179-80085201 TAAAGCCCTCAAAGGGAGCATGG + Intergenic
957526333 3:81383284-81383306 TAAATGCCCCAAAACAAGCAAGG + Intergenic
959402902 3:105924139-105924161 TAGAACCCACAAAATAAGAATGG + Intergenic
960517156 3:118615025-118615047 TAGAGCCTTCAAAGGGAGCATGG + Intergenic
961202880 3:125058178-125058200 TAAAGGCCAGAAAAGAAGCAAGG - Intergenic
961625082 3:128255957-128255979 TATAGCCCCAAACAGAAGCCAGG - Intronic
963240180 3:142995220-142995242 TAGAGACTCCAAAATAAGCACGG + Intronic
963377965 3:144494283-144494305 TAGAGCCTTCAGAGGAAGCAAGG - Intergenic
964247682 3:154672099-154672121 TACAACCCTCAAGAGAAGCAGGG - Intergenic
967223842 3:187272730-187272752 TGGAGCCCTCAGAAGGAGCATGG + Intronic
967477945 3:189942704-189942726 GATAGGCCCCAAAGGAAGCACGG + Intergenic
969956119 4:10892504-10892526 TAGAGCTTCCAAAAGATGTATGG + Intergenic
970858500 4:20675372-20675394 TAGAGCCTCCAGATGGAGCATGG + Intergenic
971379749 4:26085855-26085877 TAGAGCCCGCAGAGGGAGCATGG + Intergenic
971745472 4:30574406-30574428 TAGAGCCTCTAAAGGAAGCATGG + Intergenic
972925526 4:44001521-44001543 TAGATCCACCAAAAGCAGGAGGG - Intergenic
974402607 4:61425634-61425656 TAGAGGACCCAAAGGAACCATGG - Intronic
975922412 4:79408045-79408067 AAGAGTTCCCAAAAGAAGGATGG - Exonic
976196584 4:82537852-82537874 TAGAGCCTTCAATAGGAGCAGGG + Intronic
978045572 4:104122508-104122530 TAGAGGCCCCAAATGAAATAAGG - Intergenic
978644933 4:110918983-110919005 TAGAGCCTCCAGAAGGAGCGTGG - Intergenic
980666508 4:135945000-135945022 TAGAGTGCCCAAAAGAAACTAGG + Intergenic
980880580 4:138706324-138706346 TAAAGTTTCCAAAAGAAGCAAGG + Intergenic
981745330 4:148047060-148047082 TTCAGCACCCAACAGAAGCACGG - Intronic
981934779 4:150227969-150227991 CAAAACCCCCAAAGGAAGCATGG - Intronic
982891596 4:160859278-160859300 ATTTGCCCCCAAAAGAAGCAAGG - Intergenic
986641682 5:9878098-9878120 GAGAGCCCCCAAATGACTCATGG - Intergenic
986900643 5:12428583-12428605 TAGAGCCTCCAAAAGGAGAGTGG - Intergenic
986940009 5:12937793-12937815 TACAGGACCCAAAAGAACCATGG + Intergenic
987387975 5:17348179-17348201 TAGAGCAAGCAAAAGAAGCAGGG + Intergenic
988483308 5:31647464-31647486 TAGAGCTTCCAGAAGGAGCACGG - Intronic
988722934 5:33896657-33896679 TAGAGAGCCCAAGAAAAGCAAGG + Intergenic
989344659 5:40416457-40416479 TAGAGCCTTCAAAAGGAGCAGGG + Intergenic
989378081 5:40786310-40786332 TAGAGCCTTCAGAAGAAACATGG + Intronic
991119947 5:63001073-63001095 CAGAGCCTCCAAAGGGAGCATGG - Intergenic
993634481 5:90326944-90326966 TGGAGCTCCCAGAAGAAGCAGGG - Intergenic
993811212 5:92478583-92478605 TGGAGCCTCCAAAAGAAACAAGG + Intergenic
995479749 5:112582314-112582336 TAGGCCCCCCATAAGAAGGAAGG + Intergenic
995493406 5:112716127-112716149 AAGAACCCCAAAAAGCAGCAGGG - Intronic
995590056 5:113690094-113690116 GTGAGCCACCAAATGAAGCAAGG - Intergenic
997643785 5:135466957-135466979 GGGAGCCCCCAGAGGAAGCAGGG + Intergenic
998188720 5:140003560-140003582 TAGAGCCTCCAGAAGGAACACGG + Intronic
999572999 5:152941850-152941872 TACAGCTTCCAAAAGCAGCAGGG + Intergenic
1000397940 5:160795832-160795854 TACAGCCCCCAGAGGAAGCATGG + Intronic
1001168601 5:169394577-169394599 TAGAGCTCCCAGAAGGAACATGG - Intergenic
1002071594 5:176681644-176681666 TGGAGCCCCCAAAAGCTGCATGG + Intergenic
1002702616 5:181136207-181136229 AAGTGCCCCCAAAAAAGGCAGGG + Intergenic
1003214583 6:4097746-4097768 TGGAACACCCAAAAGAAGGAAGG + Intronic
1003628544 6:7765786-7765808 TAGAGCCTCCAGAAGGAACACGG - Intronic
1003946888 6:11084215-11084237 TAGAGCCCTCAGAGGGAGCATGG + Intergenic
1005759971 6:28959037-28959059 TACAGCTCACAAAAGCAGCATGG - Intergenic
1006005919 6:31001386-31001408 TACAGCTCACAAAAGCAGCATGG - Intergenic
1006625309 6:35393260-35393282 GAGAGCCCCGAAAGGAAACAGGG + Intronic
1008008472 6:46437792-46437814 TAGAACAACCAAAAAAAGCATGG + Intronic
1008568573 6:52793040-52793062 GAGAGGCTCCGAAAGAAGCAGGG - Intronic
1009908868 6:69902641-69902663 TACAGGACCCAAAAGAACCATGG - Intronic
1010656131 6:78514055-78514077 TAGTGCCCCCTACAGAATCAGGG + Intergenic
1013041497 6:106438439-106438461 TAGAGCCTTCAGAAGGAGCACGG - Intergenic
1014257945 6:119183009-119183031 TAGAGCCCAGAAAAGAGGCGAGG + Intronic
1015035637 6:128651056-128651078 TAGAGCAACCCAAAAAAGCAAGG - Intergenic
1015107256 6:129551413-129551435 TCGAGTACCTAAAAGAAGCAGGG + Intergenic
1015546969 6:134371245-134371267 TAGAGCCGTCAGAGGAAGCATGG - Intergenic
1016820410 6:148341725-148341747 GAGAGGCCTCAAAACAAGCAGGG + Intronic
1018088919 6:160329101-160329123 TAGTGCCTCCAAAAGAAGCCAGG + Intergenic
1019615707 7:1959357-1959379 GAGAGTCCCCAAAAGAAAGAAGG + Intronic
1020670015 7:11094818-11094840 TAGACCCCATAAAAGAAGGATGG - Intronic
1023075137 7:36474346-36474368 TACAGGACCCAAAAGAACCATGG - Intergenic
1023535993 7:41211594-41211616 TAGAGCCTTCAAAGGGAGCATGG + Intergenic
1025031470 7:55560555-55560577 TGGAGCCTCCAGAAGAAACATGG + Intronic
1027416050 7:77975903-77975925 TAGAGGAACAAAAAGAAGCATGG - Intergenic
1027910167 7:84240577-84240599 TAGAGCCTCGCAAAGAAGCATGG + Intronic
1031029088 7:116715291-116715313 TAGAGCCTCCAGAGGGAGCATGG - Intronic
1031096834 7:117430252-117430274 TAGAGCCTTCAGAGGAAGCATGG - Intergenic
1032688663 7:134260675-134260697 TAAAGCCCCAACAAGCAGCAGGG - Intronic
1033506273 7:142004523-142004545 TAGAGACTCCAAAAGGAGAAAGG + Intronic
1034150592 7:148912126-148912148 TAGAGCCCTCAGAAAGAGCATGG - Intergenic
1034398963 7:150848785-150848807 TTGAGCCTCCAAAGGGAGCATGG + Intronic
1036948688 8:13120485-13120507 GAGGCCCCCCAAAACAAGCATGG - Intronic
1037177239 8:15961903-15961925 CAAAGCCACCAAGAGAAGCATGG + Intergenic
1039800424 8:40949922-40949944 TAGAGCCTTCAAAGGGAGCACGG + Intergenic
1040600657 8:48880604-48880626 TAGAGCCCTCAGAAGGAGCAGGG - Intergenic
1041721604 8:60981043-60981065 TAGAGCCTCCAAATGGAGGAGGG + Intergenic
1042539973 8:69898253-69898275 TTGAGCCCCCAATAGAAGAAGGG + Intergenic
1043647039 8:82534510-82534532 AAGAGCTCCCAAAGGAAGCATGG - Intergenic
1045452341 8:102340141-102340163 TATAGCCCCCATAAGTAGCAAGG + Intronic
1045884510 8:107079553-107079575 TAGAGGACCCAGAAGAAGAAAGG - Intergenic
1046198240 8:110890672-110890694 TACAGGACCCAAAAGAACCATGG - Intergenic
1047002325 8:120585348-120585370 AAGAGCTCCAAAGAGAAGCATGG - Intronic
1048599342 8:135902462-135902484 TAGAGTCCTCAGAAGGAGCACGG - Intergenic
1050173333 9:2844877-2844899 TAGAGCCTTCAAAAGGTGCAGGG - Intergenic
1050652199 9:7787479-7787501 TATAGGACCCAAAAGAACCATGG - Intergenic
1051334222 9:16052160-16052182 GAGAGGCTCCAACAGAAGCATGG - Intronic
1052288526 9:26816116-26816138 TAGAGTCCCCAAAGGAAGAACGG + Intergenic
1052620342 9:30900180-30900202 TAGAGCCTCCAAAGGGAGCCTGG - Intergenic
1054896441 9:70318184-70318206 CAGCGCCCCCATAGGAAGCATGG + Intronic
1056197577 9:84243179-84243201 AAGATGACCCAAAAGAAGCAGGG - Intergenic
1057255732 9:93545506-93545528 GACAGGCCCCAAAAGAAACAGGG - Intronic
1058203855 9:102077302-102077324 CAGAGCCTTCAAAGGAAGCATGG - Intergenic
1058487338 9:105455321-105455343 CAGAGCCACCAAATGAGGCATGG - Intronic
1058502954 9:105640260-105640282 CACTGCACCCAAAAGAAGCAGGG - Exonic
1059417021 9:114168566-114168588 TAGAGCCGCCAACAGAGGCTGGG - Exonic
1060674071 9:125496565-125496587 CAGAGCCTCCAGAAGCAGCATGG + Intronic
1203438271 Un_GL000195v1:164160-164182 ATGAGGCCCCAAAAGAGGCAGGG + Intergenic
1185517309 X:709932-709954 TAGAGCCTCCAGAGGAAGCATGG - Intergenic
1185653506 X:1666380-1666402 TAGAGCCTCCAGAGGGAGCACGG - Intergenic
1185655796 X:1684544-1684566 TAGAGCCTCCGGAGGAAGCATGG + Intergenic
1185764600 X:2715357-2715379 TAGAGCCCCTAGAGGGAGCATGG - Intronic
1185831257 X:3305209-3305231 TAGAGCCTCCAGAGGGAGCATGG - Intergenic
1186138865 X:6549541-6549563 TAGAGCCTCCAGAGGAAGCATGG + Intergenic
1187204051 X:17165324-17165346 TACTGCCACCAAAAGAACCAGGG + Intergenic
1188410114 X:29861546-29861568 TATAGCATCCAAAATAAGCAAGG + Intronic
1189055188 X:37692291-37692313 GAGTGCCCCCAAATGAGGCAGGG + Intronic
1189577408 X:42369079-42369101 TAGAGCCTCCAAAGGGATCATGG + Intergenic
1192269346 X:69564287-69564309 TAGAGCCTCCAGAGGGAGCAGGG - Intergenic
1193575795 X:83194062-83194084 TAAAGCCACCTAGAGAAGCATGG + Intergenic
1195028837 X:100906768-100906790 TAGAACCTCCAAAAGGAACATGG - Intergenic
1195123392 X:101780385-101780407 AAGAGTCCCCAAGAGAAGGATGG - Intergenic
1196266753 X:113658012-113658034 TACAGCCTGCACAAGAAGCATGG + Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1198551935 X:137754229-137754251 TAGAGGCTCCATAAGAACCAAGG + Intergenic
1199553098 X:149078599-149078621 TACAGAACCCAAAAGAACCACGG + Intergenic
1201245313 Y:11997458-11997480 TAGAGCCTCCATAGGGAGCATGG + Intergenic