ID: 924994855

View in Genome Browser
Species Human (GRCh38)
Location 2:350142-350164
Sequence TCAGAGAAGCAGAGAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924994855_924994861 19 Left 924994855 2:350142-350164 CCTTCCACTCTCTGCTTCTCTGA No data
Right 924994861 2:350184-350206 CACGTTGAAGTGGGATCATATGG No data
924994855_924994858 9 Left 924994855 2:350142-350164 CCTTCCACTCTCTGCTTCTCTGA No data
Right 924994858 2:350174-350196 TCTTAGGTTCCACGTTGAAGTGG No data
924994855_924994857 -7 Left 924994855 2:350142-350164 CCTTCCACTCTCTGCTTCTCTGA No data
Right 924994857 2:350158-350180 TCTCTGAGTTCAGCTGTCTTAGG No data
924994855_924994859 10 Left 924994855 2:350142-350164 CCTTCCACTCTCTGCTTCTCTGA No data
Right 924994859 2:350175-350197 CTTAGGTTCCACGTTGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924994855 Original CRISPR TCAGAGAAGCAGAGAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr