ID: 924996764

View in Genome Browser
Species Human (GRCh38)
Location 2:368554-368576
Sequence GCCTGTGTGCCCTCACATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924996759_924996764 -1 Left 924996759 2:368532-368554 CCTCCTTAGCTCTTCCCACCGAG No data
Right 924996764 2:368554-368576 GCCTGTGTGCCCTCACATAGAGG No data
924996758_924996764 0 Left 924996758 2:368531-368553 CCCTCCTTAGCTCTTCCCACCGA No data
Right 924996764 2:368554-368576 GCCTGTGTGCCCTCACATAGAGG No data
924996760_924996764 -4 Left 924996760 2:368535-368557 CCTTAGCTCTTCCCACCGAGCCT No data
Right 924996764 2:368554-368576 GCCTGTGTGCCCTCACATAGAGG No data
924996757_924996764 9 Left 924996757 2:368522-368544 CCTGAGATGCCCTCCTTAGCTCT No data
Right 924996764 2:368554-368576 GCCTGTGTGCCCTCACATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924996764 Original CRISPR GCCTGTGTGCCCTCACATAG AGG Intergenic
No off target data available for this crispr