ID: 925002812

View in Genome Browser
Species Human (GRCh38)
Location 2:419870-419892
Sequence ACAATGTATCTGGGCACATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925002812_925002817 23 Left 925002812 2:419870-419892 CCATATGTGCCCAGATACATTGT No data
Right 925002817 2:419916-419938 TTCCATGAACTGTAACATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925002812 Original CRISPR ACAATGTATCTGGGCACATA TGG (reversed) Intergenic
No off target data available for this crispr