ID: 925003778

View in Genome Browser
Species Human (GRCh38)
Location 2:426536-426558
Sequence AGGCACAAAGGGGGCTCCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925003767_925003778 21 Left 925003767 2:426492-426514 CCACAGGCACGCAGGGGGTTCCG No data
Right 925003778 2:426536-426558 AGGCACAAAGGGGGCTCCGATGG No data
925003771_925003778 1 Left 925003771 2:426512-426534 CCGCAGGCACGCAGAGGGCTCCG No data
Right 925003778 2:426536-426558 AGGCACAAAGGGGGCTCCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925003778 Original CRISPR AGGCACAAAGGGGGCTCCGA TGG Intergenic