ID: 925009112

View in Genome Browser
Species Human (GRCh38)
Location 2:468490-468512
Sequence GCAGGACGCAGCGGGGGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925009089_925009112 29 Left 925009089 2:468438-468460 CCCCTTGAACCCCGCCTCCCGCA No data
Right 925009112 2:468490-468512 GCAGGACGCAGCGGGGGGCGGGG No data
925009097_925009112 11 Left 925009097 2:468456-468478 CCGCATCCTCCTGCAACAGCCTG No data
Right 925009112 2:468490-468512 GCAGGACGCAGCGGGGGGCGGGG No data
925009091_925009112 27 Left 925009091 2:468440-468462 CCTTGAACCCCGCCTCCCGCATC No data
Right 925009112 2:468490-468512 GCAGGACGCAGCGGGGGGCGGGG No data
925009096_925009112 12 Left 925009096 2:468455-468477 CCCGCATCCTCCTGCAACAGCCT No data
Right 925009112 2:468490-468512 GCAGGACGCAGCGGGGGGCGGGG No data
925009092_925009112 20 Left 925009092 2:468447-468469 CCCCGCCTCCCGCATCCTCCTGC No data
Right 925009112 2:468490-468512 GCAGGACGCAGCGGGGGGCGGGG No data
925009102_925009112 -8 Left 925009102 2:468475-468497 CCTGGAGCTCCCTGTGCAGGACG No data
Right 925009112 2:468490-468512 GCAGGACGCAGCGGGGGGCGGGG No data
925009099_925009112 5 Left 925009099 2:468462-468484 CCTCCTGCAACAGCCTGGAGCTC No data
Right 925009112 2:468490-468512 GCAGGACGCAGCGGGGGGCGGGG No data
925009093_925009112 19 Left 925009093 2:468448-468470 CCCGCCTCCCGCATCCTCCTGCA No data
Right 925009112 2:468490-468512 GCAGGACGCAGCGGGGGGCGGGG No data
925009090_925009112 28 Left 925009090 2:468439-468461 CCCTTGAACCCCGCCTCCCGCAT No data
Right 925009112 2:468490-468512 GCAGGACGCAGCGGGGGGCGGGG No data
925009100_925009112 2 Left 925009100 2:468465-468487 CCTGCAACAGCCTGGAGCTCCCT No data
Right 925009112 2:468490-468512 GCAGGACGCAGCGGGGGGCGGGG No data
925009095_925009112 15 Left 925009095 2:468452-468474 CCTCCCGCATCCTCCTGCAACAG No data
Right 925009112 2:468490-468512 GCAGGACGCAGCGGGGGGCGGGG No data
925009094_925009112 18 Left 925009094 2:468449-468471 CCGCCTCCCGCATCCTCCTGCAA No data
Right 925009112 2:468490-468512 GCAGGACGCAGCGGGGGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925009112 Original CRISPR GCAGGACGCAGCGGGGGGCG GGG Intergenic