ID: 925012985

View in Genome Browser
Species Human (GRCh38)
Location 2:499942-499964
Sequence TGTAACACAGGAAACCTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925012985_925012993 21 Left 925012985 2:499942-499964 CCGACCAGGTTTCCTGTGTTACA No data
Right 925012993 2:499986-500008 CTCACAGGGTCAGCACCAACGGG No data
925012985_925012989 7 Left 925012985 2:499942-499964 CCGACCAGGTTTCCTGTGTTACA No data
Right 925012989 2:499972-499994 TTATCTCCAAATGCCTCACAGGG No data
925012985_925012988 6 Left 925012985 2:499942-499964 CCGACCAGGTTTCCTGTGTTACA No data
Right 925012988 2:499971-499993 TTTATCTCCAAATGCCTCACAGG No data
925012985_925012992 20 Left 925012985 2:499942-499964 CCGACCAGGTTTCCTGTGTTACA No data
Right 925012992 2:499985-500007 CCTCACAGGGTCAGCACCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925012985 Original CRISPR TGTAACACAGGAAACCTGGT CGG (reversed) Intergenic
No off target data available for this crispr