ID: 925013454

View in Genome Browser
Species Human (GRCh38)
Location 2:503680-503702
Sequence GCTTTTACACGCGTGTTCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925013454_925013459 16 Left 925013454 2:503680-503702 CCGAGGAACACGCGTGTAAAAGC No data
Right 925013459 2:503719-503741 GATCCCACAGCAGCAGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925013454 Original CRISPR GCTTTTACACGCGTGTTCCT CGG (reversed) Intergenic
No off target data available for this crispr