ID: 925013924

View in Genome Browser
Species Human (GRCh38)
Location 2:507594-507616
Sequence CTCCTTCTGTTCTCTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925013924_925013932 16 Left 925013924 2:507594-507616 CCAGAAACAGAGAACAGAAGGAG No data
Right 925013932 2:507633-507655 CCCATTGACCCAGGGCAGGGAGG No data
925013924_925013927 7 Left 925013924 2:507594-507616 CCAGAAACAGAGAACAGAAGGAG No data
Right 925013927 2:507624-507646 TGTTTTATTCCCATTGACCCAGG No data
925013924_925013934 17 Left 925013924 2:507594-507616 CCAGAAACAGAGAACAGAAGGAG No data
Right 925013934 2:507634-507656 CCATTGACCCAGGGCAGGGAGGG No data
925013924_925013929 12 Left 925013924 2:507594-507616 CCAGAAACAGAGAACAGAAGGAG No data
Right 925013929 2:507629-507651 TATTCCCATTGACCCAGGGCAGG No data
925013924_925013930 13 Left 925013924 2:507594-507616 CCAGAAACAGAGAACAGAAGGAG No data
Right 925013930 2:507630-507652 ATTCCCATTGACCCAGGGCAGGG No data
925013924_925013928 8 Left 925013924 2:507594-507616 CCAGAAACAGAGAACAGAAGGAG No data
Right 925013928 2:507625-507647 GTTTTATTCCCATTGACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925013924 Original CRISPR CTCCTTCTGTTCTCTGTTTC TGG (reversed) Intergenic
No off target data available for this crispr