ID: 925015893

View in Genome Browser
Species Human (GRCh38)
Location 2:523858-523880
Sequence CAGGGAATGACAGTGGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925015885_925015893 12 Left 925015885 2:523823-523845 CCTCTTCTCTCGGAAGGGTGAGA No data
Right 925015893 2:523858-523880 CAGGGAATGACAGTGGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925015893 Original CRISPR CAGGGAATGACAGTGGTTGT TGG Intergenic
No off target data available for this crispr