ID: 925017883

View in Genome Browser
Species Human (GRCh38)
Location 2:545518-545540
Sequence CGCTGCTGCCGTGGAGCACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925017880_925017883 -1 Left 925017880 2:545496-545518 CCCACAGACGTTTGAGAAGCATC No data
Right 925017883 2:545518-545540 CGCTGCTGCCGTGGAGCACACGG No data
925017879_925017883 6 Left 925017879 2:545489-545511 CCTGATGCCCACAGACGTTTGAG No data
Right 925017883 2:545518-545540 CGCTGCTGCCGTGGAGCACACGG No data
925017877_925017883 22 Left 925017877 2:545473-545495 CCTGATCTGCCTTTCTCCTGATG No data
Right 925017883 2:545518-545540 CGCTGCTGCCGTGGAGCACACGG No data
925017881_925017883 -2 Left 925017881 2:545497-545519 CCACAGACGTTTGAGAAGCATCG No data
Right 925017883 2:545518-545540 CGCTGCTGCCGTGGAGCACACGG No data
925017878_925017883 13 Left 925017878 2:545482-545504 CCTTTCTCCTGATGCCCACAGAC No data
Right 925017883 2:545518-545540 CGCTGCTGCCGTGGAGCACACGG No data
925017876_925017883 23 Left 925017876 2:545472-545494 CCCTGATCTGCCTTTCTCCTGAT No data
Right 925017883 2:545518-545540 CGCTGCTGCCGTGGAGCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925017883 Original CRISPR CGCTGCTGCCGTGGAGCACA CGG Intergenic
No off target data available for this crispr