ID: 925018258

View in Genome Browser
Species Human (GRCh38)
Location 2:547805-547827
Sequence AGGAGAGTGTTTCACTACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925018253_925018258 16 Left 925018253 2:547766-547788 CCAGGGAGGAACAGCTGGGCACA No data
Right 925018258 2:547805-547827 AGGAGAGTGTTTCACTACACAGG No data
925018249_925018258 23 Left 925018249 2:547759-547781 CCACTACCCAGGGAGGAACAGCT No data
Right 925018258 2:547805-547827 AGGAGAGTGTTTCACTACACAGG No data
925018248_925018258 24 Left 925018248 2:547758-547780 CCCACTACCCAGGGAGGAACAGC No data
Right 925018258 2:547805-547827 AGGAGAGTGTTTCACTACACAGG No data
925018252_925018258 17 Left 925018252 2:547765-547787 CCCAGGGAGGAACAGCTGGGCAC No data
Right 925018258 2:547805-547827 AGGAGAGTGTTTCACTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925018258 Original CRISPR AGGAGAGTGTTTCACTACAC AGG Intergenic
No off target data available for this crispr